Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1926
Contig Information
Length 1435 bp
Tissue Shoot grown with dessication
Clones 41 Clones [Download: CSV  ,  FASTA ]
whvd10o17    whvd10o18    whvd11j07    whvd12b12    whvd12f05    whvd4f21    whvd5d13    whvd5f16    whvd5k18    whvd6f19    whvd6m04    whvd8n12    whvd13f19    whvd14b10    whvd15f02    whvd15o23    whvd16b03    whvd16n06    whvd17j24    whvd19h22    rwhvd10o18    rwhvd12b12    rwhvd12f05    rwhvd2b22    rwhvd4f21    rwhvd5d13    rwhvd5f16    rwhvd5k18    rwhvd6f19    rwhvd6m04    rwhvd8n12    rwhvd9i10    rwhvd13h06    rwhvd14b10    rwhvd15f02    rwhvd15o23    rwhvd16b03    rwhvd16n06    rwhvd17j24    rwhvd19h22    rwhvd20f05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0592500 [Oryza sativa (japonica cultivar-group)] >gi|122246902|sp|Q10HD0|CB23_ORYSJ RecName: Full=Chlorophyll a-b binding protein, chloroplastic; AltName: Full=LHCII type I CAB; Short=LHCP; Flags: Precursor >gi|152013384|sp|A2XJ35|CB23_ORYSI RecName: Full=Chlorophyll a-b binding protein, chloroplastic; AltName: Full=LHCII type I CAB; Short=LHCP; Flags: Precursor >gi|50839002|gb|AAT81763.1| chlorophyll a/b binding protein [Oryza sativa (japonica cultivar-group)] >gi|108709618|gb|ABF97413.1| Chlorophyll a-b binding protein, chloroplast precursor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549057|dbj|BAF12500.1| Os03g0592500 [Oryza sativa (japonica cultivar-group)] >gi|125544706|gb|EAY90845.1| hypothetical protein OsI_12453 [Oryza sativa Indica Group] >gi|125586998|gb|EAZ27662.1| hypothetical protein OsJ_011145 [Oryza sativa (japonica cultivar-group)]
Score 1170
Evalue 1.57368e-126
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1926
AGCGCGCGCCATGCCAGTTGATGATCTTGAGTAATGACACACGATTCTTCCATCCATTCCCTCGTGCACACGTTGGGCTTAATTAATTTACATTGCGCAC
AGCCAGAGAGAGGACCTCTCGCTCGCTCGATCATGGTACAAATAAACACACAAAGTACGTGCAGCTACACGTTGATCCACGACGTACAAGTACACATGCA
TATCTCGTCCGATGGACGGACGGACGGACGGATGGCTAAACACATTTAGCTTCCGGGGGCGAAGTTGGTGGCAAAGGCCCACGCGTTGTTGTTGACCGGG
TCAGCGACATGGTCGAAGAGGTTCTCAACGGGTCCCTTTCCGGTGACGATGGCCTGCACGAAGAAGCCGAACATGGAGAACATGGCGAGGCGGCCGTTCT
TGAGCTCCTTGACCTTGAGCTCCGCGGCGGTGTCGGGGTCGTCGGCGAGGCCAAGCGGGTCGAAGGCGCCGCCCGGGTAGATGATGTCGAGGCCCTCGCC
GAGGGGGCCGCCACCAACACGGTAACCCTCAATGAAGCCCATGAGCACCACCTGAACCGCCCAGATGGCCAGGATGCTCTGCGCGTGCACCAGGTTGGGG
TTGCCCAGGTAGTCGAGGCCGCCCTCGGAGAAGATCTGGGCGCCGGCCTTGAACCACACGGCCTCGCCGAACTTGATGCCGTTCTTGGACAGGATCTCCG
GGAACACGCAGCCCAGGGCGCCGAGCATCGCCCACCGCGAGTGGATCACCTCCAGCTCCCGGTTCTTGGCGAAGGTCTCTGGGTCAGCCGACAATCCGGC
GGTGTCCCATCCGTAGTCGCCGGGGAACTCGCCGGTCAGGTACGACGGGGTCTGCTCGGAGAACGGGCCCAGGTACTTGGGACGGTCAGGGCCGTACCAG
ATGCTCTGGGGCGCGCTCTTGACGGTCCGGCGCATGGTGATGCGGCCGCCGAAGTCGCCGACGCTGCGGAGCGAGGTCATCGCGCCGCGGGGCGGTGCCG
AGGAAGCTGGTCGTCTGGTGCAGCGCCGACGCGGCCATTTCGCTGGTGGCTAGGGCTGCCTGCGAGCTCAGTGAGATGAACTGGTGGATGGTCGCCGTGG
TCGTCCTCGGCGTGGCGCCTGAGAACAAGGCAGGTCAGTTCGAGGTGGCCGCCGGCCAGTCCGGCGAGGGCTGCAGCTGCGGCGACAACTGCAAGTGCAA
CCCCTGCAACTGTTAAGCTGCATGCACTCGTACCGTCGTACGTACGTGTGATGGTGTGAGAGTATACGTGAATAACGAGCGTCTGATCTGATGGAGTCGA
GCAAGGGTGCGTGTGCATGTGCGTGTGGTTTACTTCGCTCGCTCTCCGCCTATGCTCTGCCCTTGGTGTACCTTGTGTGTATGTGTGTGCATGTGTACCC
TGTAATTGCTTCATCTATCTCCACTATGGATGGAG
page-top