Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1925
Contig Information
Length 749 bp
Tissue Shoot grown with dessication
Clones 37 Clones [Download: CSV  ,  FASTA ]
whvd10a07    whvd10n01    whvd11m05    whvd2f21    whvd3i19    whvd4l07    whvd6i08    whvd6j03    whvd6o19    whvd7o05    whvd9d19    whvd13o01    whvd15a08    whvd16o15    whvd19d21    whvd19j16    whvd19p20    whvd20b01    rwhvd10a07    rwhvd10n01    rwhvd11l03    rwhvd11l04    rwhvd11m05    rwhvd2f21    rwhvd3i19    rwhvd4g23    rwhvd4l07    rwhvd6i08    rwhvd6j03    rwhvd7o05    rwhvd9d19    rwhvd15a08    rwhvd16o15    rwhvd19d21    rwhvd19j16    rwhvd19p20    rwhvd20b01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit lipid transfer protein precursor [Triticum aestivum] >gi|46252474|gb|AAS84745.1| lipid transfer protein [Triticum aestivum] >gi|55792862|gb|AAV65513.1| lipid transfer protein [Triticum aestivum]
Score 462
Evalue 2.33353e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1925
TTTTTTTTTTCAAATAACGACGCGTGTTAACTGAATAGAGCTAGATTAATTTATAATACCATGAGTGCACATGGTACAAAGTACAACAAACTCCCGTCTC
TGCTCAAAGGGAGTGAACGAACAATCAAACGCTGATACAAAATAGATACAACAGTGGCCGGCTATGCAGAGCTGGCTCGACGTACGTACTCCTGTCTCTC
ACATGGAGATCATATCAGAGCATTTATTCATGTATATGTGTATATATATATATATATATGTGTGTGTGTGACCTCAACGTACTCGGCATCTATCGCTGGA
GCTATAATCGGCGATGATGGCGGCAAGTAATCGATCAGTGGATCTTAGAGCAGTCCACGGATGCGCTGATGGAGTAGGGGATGCTGACGCCGCACTTGGA
GGGGATACTTGCAGCCTTTCCGGGGTTGAGCCCACCGGCAGCACTCTTGATGCACCTGCATGCCGCTTGCTTGTCGGCGGTGCTCCGCGCTAAGCCGGCC
AATCTCCTAACTCCGGAACAGCAGGCCCCAGGCGGGCTGGCCCCGCTGCCTTTTGCGTAGGAGACGCAGGAGGCCAGGGCAGAGTTCACCTGACCGCAGG
AGATCGCCGCGTCGGAGGCTACCAGGAGCATTGCCGCCACCAGGGCGACCAGCACGAGCTTTGTTGCTGCAGTGCGAGCCATCTCGACCGAGTTAGCTGT
AGTTGTGGTGGAGGGCTCGCAGGGAGAGGGTGGGTAATTAGCTAGATTG
page-top