Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1921
Contig Information
Length 1758 bp
Tissue Shoot grown with dessication
Clones 29 Clones [Download: CSV  ,  FASTA ]
whvd10c08    whvd10c19    whvd10e07    whvd11k13    whvd12l21    whvd1c13    whvd3j10    whvd4k21    whvd9i09    whvd9j19    whvd13k09    whvd13m20    whvd14o20    whvd15j02    whvd16g15    rwhvd10c08    rwhvd10e07    rwhvd11k13    rwhvd12l21    rwhvd1c13    rwhvd1d14    rwhvd3j10    rwhvd4e03    rwhvd4k21    rwhvd9i09    rwhvd9j19    rwhvd13m20    rwhvd14o20    rwhvd16g15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PS II 10 kDa protein [Phyllostachys pubescens]
Score 483
Evalue 3.11389e-46
Total Hit Count 61
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1921
AGAAGACGGAGTCTGCCAAGGACGCCACATGGCAGGCGCAGGAGAAGCTGAAGCAATACAACGACGTCGCGTCGGAGAAGGCCGCGAACGTCAAGGACGC
CGCTGCGGAGAAGGCCCCGGCCGCCAAGGACGCCGCGTGGAAGAACGCCGAGGCGGCCAAGGGAACGGTCGGGGAGAAGGCAGGGGCGGCCAAGGACGCC
ACGTTGGAGAAGACGGCGTCGGCCAAGGACGCCGCATGGGAGACGGCGGAGGCGGCCAAGGACACGGCCTGGGAGACGGCGGAGGCGGCCAAGGATAAGG
CCAACCAGGGGTACGAGAAGGTGAAGGAGAAGGTTGGGGAGGTGAAGGACAAGGTCACCGGCGCGGCAGCCGACGGCAAGGCGAAGAAGCACCGCAAGGA
CGACGAGCTGTGAATGAGCACCATCGTTCCGCATTTCTTGCAATAGCTTTACATGAATGTTTTCAGTGTTCACGCTAGTTTTTTTTTCTGCTGTTCCTTC
TTGTACAATAATGTGAGACCATCTGTAGAGAACCCTGCACGATCAGACGAGTTTCTTTTGAANACAGACAGAGCTTGAGAGAGCGCGCGCGAGATGGCAG
CCTCCATGATCACCTCGCCGATTGTGGCGCCGACGAGCGTCCCCTCCCTCTCCCGCCGGGGTTCCTCCTTCGCCGTCGTCTGCAGCGGTGGCAAGAAGAT
CAAGGTCGACAAGCCCCTTGGACTTGGAGGCGGCTTGACAGTCGACATCGACGCCAACGGCAGGAAGGTGGGCAAGAAGGGCGTGTACCAGTTCGTTGAC
AAGTACGGCGCCAACGTCGACGGCTACAGCCCAATCTACACGCCAGAGGAATGGTCTGAATCTGGTGACCGCTACGCCGGCGGAACGACCGGGCTTCTTA
TCTGGGCCGTCACCCTCGCCGGCCTCCTCGGCGGCGGCGTCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAAGAGAGCATCTACGTGTAACACAG
GGCCGGGTCTCTGCTTGCATGCACGTCTCTGTAATCTACATAGCTACCTCCTGTGAATGTATGCAATCAACGATGCAAAGTAATTGATCCGAACAGATGG
TTTATGTGTATGTACGTAACGCTGTAACGATATACTTCCTACTTTGGAAACTGTAAAAGGGTGGATTCTTGGAGCCCGTATGCACGCACCCTCTACCATG
CATAGGCGCATCTGTTCCTAGGTATTTGGGACGCGCCTGACTCGTGTCACAGAGTGCCCAGAAGATTAATATAGTGGCCGCCGGCGGTCGCCACCTCGCT
CACTGCCCTCGATCGAATTGAACCCCCACTCTGCGACTGCCCGATGGAATCAACAGCGAGACTGAGACGGGGAAGAAGAAATTGGGTGTGGGAGAAATGT
TGTTGCCGGTGTCGGATTTGGGGGAGGAGACGAAAAGGAAGTGTAAAGCAGCGTCTCCTGTGGGAGCTCCTATTTGACGCATTTTACGTCAAATTCTGGA
TCTGCTGCTTGACAATGAGAGCGGCTAACCAGTCGACCTGACAAGTGTTGCTGACTATAGAGGAGCACATATGTCTAAGGCTGGTCACAATGGGCAGGAA
CGTAAGCTAGTAACCTACACAGTTTCCTAGACTATGTTACTACCTCCATAGTGGGAAGGAACATGTATGTAGTGTCATGCAGCGATGTATTTATTAGGAT
ATAGACTCATTGTTTCTTGAAGTGTGTAATGTTCCGGTAACTTAGCTAGTTACCACAA
page-top