Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1919
Contig Information
Length 1891 bp
Tissue Shoot grown with dessication
Clones 28 Clones [Download: CSV  ,  FASTA ]
whvd10b08    whvd10b19    whvd10g03    whvd11j14    whvd12k13    whvd1l18    whvd4n03    whvd8d02    whvd13f02    whvd14l16    whvd16l02    whvd20a18    whvd20a19    whvd20g19    rwhvd10b08    rwhvd10b19    rwhvd11j14    rwhvd12k13    rwhvd1g12    rwhvd1l18    rwhvd4n03    rwhvd13f02    rwhvd14l16    rwhvd16l02    rwhvd17p17    rwhvd20a18    rwhvd20a19    rwhvd20g19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine decarboxylase precursor [Triticum aestivum]
Score 2003
Evalue 0
Total Hit Count 362
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1919
CTATCGGCTGTGAAGTAGTTTCGATTACAGAACATGAATATGATAACAAAGTGACACTCGTCTTAGAAAAAAAATGCTTATTTATCAGTTTGAGACAACT
TCTCCCCAGAAGTACGCTCATTGTGGCAGACGCAGCAAACCACCTAGAGCTAATAGTTTATTCGGAGTAGCAATAGCCTGGCCAGCTGCTTCACAGTAAC
CAAACGACAAACTTAGTCAGAACAAAGTCCACAGACGGAACAGCGACAGCCAATCACTCGCACAGCACCGCGCCCTCCTCCAGGGAATCCTCCTCCGCCC
GCCATGCGAGGAGGTTGGCGAGCTTGCCTTCCTTGACCAGAGGGTGGCTCTGCACACTCTCGGCCTCGAAGCAGTGGAAGACGGACCTGGGCGACCCGGC
AGAGACAGCAACCTCTTCGTTCGCGGCAAAGCTCTGGTAGATGAGGACGCCCCCGCAGGGGAGCTCCTGCTCCACAACGTTGTTGCAGTCGTATGCCTCA
GCTTCGAGCTTCTTGCCCCAGGTGGCGGCGTGGCCACGGCCACCGAAGATGGTGACCGCCACAGAGAACTCTGAAGGGCCAAAGCACCGGAGGACCCTCT
TGACGATGTCGCCGTAGGCCAGGGCGGAGGCGTCCATGCCCATGACCTCGTAGCTCGCGTAGCTGAAGCCGTCCTCGGGGGTCACATGGATGGTGGAGAC
GGCAGATCCGTTGATGGCGTTCATGGAGTAGCCGCAGGGCTCGAAGTCGAAGTCACAGACCTCCATCTCAGGGATAATGTCAGAGATTCCAGAGAGCTTG
GTCATCTCCTTGGCACAGGAAACGTGGCCATCAGCTTGAGTCTTGAAGAAGACAGAGGCCTTCTTCTTGTCCAGCCCAGTCATGCACATCTCCAGGGTGA
CCATGGGCTGCTCAGGTTGCTCGGTGGCATAGTAGATGTGCCACTTCTGGCCAGGCTTCGCTGGGTCTCCGATCACATAAGCATTGCCACCAGACTTCAG
GTGGCCGAAGTAGCGGTTCAGGACATCAACCTCCTCAGAGAAGCTCCTGTGGGGAGCAGGCTGTGCGCCGGGGAAGATGAACATCCCACGAGAGTACTTG
ACGGCAGCAAGCGGCATGCACAGCTCTTCAGCAAGCTCAAGAATCCTAGGAATGGTGAGCAGGAGCATGGTAGTCCCACAGGTCTTGATCACAATCTTCT
GAGAATAGATGAACAGGCTGGACTCAGATAGCACATACGAGTCGAAGTCCTTGTTGGAGAGCTCGGACACAATGGTGCACCGTGCAAGATCAAGAACAGA
GTCAATCTGGGCCCTAGAGAGGGCGCGCAGGCCACGACCATGAGGGTCGGCAAAGATCGATGCCTCGGAGAAGGTGATCTCGAGGCGCTTCTCGTAGCCC
TCGAACCCGATTGCAGAGGTCGGGGCAGCCATTGTTGCAGTTTGAGTCAGAAAGCAGAGCAGAGAGGAACAGAGGGAGTAAGACTAGAGAACTGGTCGAT
TATCGTGAAGCAGGCCAGAGAGATTGGTGGGAGAAAAGAGTCAGAATAAAATTGCATAAAAATCCTAAACTACGGGAAGGGGATGCCAAAAACGATATCA
GGATGGCTTCTTCGCGCAGTTCGAGTATGCAGCAGAGAACTTCTTGGCGCCTCCAGCAGGTCGAACGTCTTCAATGCTGTAGCCGAGGGGAGCTTCGTAC
ATCAGGGAACTACTACTGCTAGACTTTTTGCCACCCTTTGACTCCATTAGCACATTCACTAAAGGTTCCTGGGAAAAATTGTATGGTAACCCCGATCCCG
AGCGCGCCCGCTTGTTCCGATTCCGATCTCAAGAATTCCCCCTCTCCCGACACAGATCTCGAGCACTCCCAACGAGTTCTGCTCTCTCTTT
page-top