Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1917
Contig Information
Length 2406 bp
Tissue Shoot grown with dessication
Clones 27 Clones [Download: CSV  ,  FASTA ]
whvd10g20    whvd12i08    whvd12l09    whvd1b13    whvd1d11    whvd1m09    whvd6p07    whvd8f02    whvd8f13    whvd13f24    whvd14n21    whvd15h04    whvd15l14    whvd16e18    whvd16f23    whvd18n17    whvd19a11    whvd19e11    rwhvd10k05    rwhvd1b13    rwhvd8f02    rwhvd8f13    rwhvd13c08    rwhvd13f24    rwhvd14n21    rwhvd16f23    rwhvd19a11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Glycine dehydrogenase [decarboxylating], mitochondrial; AltName: Full=Glycine decarboxylase; AltName: Full=Glycine cleavage system P-protein; Flags: Precursor >gi|2894358|emb|CAB16911.1| P-protein [Flaveria anomala]
Score 2761
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1917
GCGCACGGTTCGGCGTGCCCATGGGGTACGGCGGCCCGCACGCTGCGTTCCTCGCCACCTCCCAGGAGTACAAGCGGCTGATGCCCGGCCGCATCATCGG
AGTGAGCGTCGACTCCAGCGGCAAGCCCGCGCTCCGCATGGCGATGCAGACCAGGGAGCAGCACATCCGGCGAGACAAGGCCACCAGCAACATCTGCACC
GCGCAGGCGTTGCTCGCCAACATGGCAGCGATGTATGCTGTCTACCATGGGCCTGCTGGCCTGAAGGCGATCGCCGACCGTGTCCATGGCCTGGCTGGTA
CTTTCGCCCATGGTTTGAAGAAGCTCGGGACAGTGACGGTGCAAGAGCTGCCCTACTTCGACACGGTCAAGATCACTTGCGCTGATGCTAATGCGATTGC
CGAGGAGGCCCGCAAAAACGAGATGAACCTTCGCGTTGTCGACGCGAACACGATCACCGTTGCCTTCGATGAGACCACCACCTTGGAGGATGTTGACAAG
CTGTTCAAGGTTTTCTCTGGTGGCAAGCCAGTGGACTTCACAGCTGAATCCATCGCACCTGAGGTCTCAAGCTCAATTCCTCCTAGCCTTGTGCGCGACA
GCCCCTACTTGACTCACCCAATCTTTAGCATGTACCACACTGAGCACGAGCTCCTCCGTTACCTGCATAAGTTGCAATCCAAGGATCTCTCACTGTGCCA
CAGTATGATCCCTCTTGGTTCTTGCACCATGAAACTAAATGCTACCGTCGAGATGATGCCTGTCACCGATCCCAAGTTCGCCAACATGCACCCATTTGCC
CCTATTGATCAAGCTGCTGGCTATCATGAAATGTTTGACAACCTGGGCGATCTGTTGAACACCATCACTGGTTTTGATTCGTTCTCTTTGCAACCGAATG
CTGGTGCTTCAGGAGAGTATGCTGGACTGATGGTTATTCGGGCCTACCACAAGGCAAGAGGAGACCACCACCGAAATGTCTGCATCATTCCTGTCTCTGC
GCACGGTACAAACCCTGCAAGTGCTGCTATGTGTGGAATGAAGATTGTTGCCGTTGGAACTGATGCCAAAGGTAACATTAACATTGAGGAGTTGAGGAAA
GCTGCTGAAGCAAACAAGGACAACCTGCTCTGCTCTGATGGTTACCTATCCTTCAACCCATGGAGTCTATGAAGAAGGCATTGATGAGATATGCAGGATT
ATTCATGAGAACGGCGGTCAGGTCTATATGGATGGAGCTAACATGAACGCTCAGGTTGGGTTGACAAGCCCTGGTTTTATTGGAGCAGATGTTTGCCATC
TTAACCTTCACAAGACATTTTGCATTCCACATGGTGGGAGGTGGTCCTGGCATGGGGTCCTATTGGTGTCAAGAAGCACTTGGCGCCATTTTTGCCATCT
CATCCAGTGATCCCCACTGGTGGCTTCCCTCTCCCTGAGAAAACCAACCCTCTTGGTTCCATTTCTGCTGCTCCATGGGGATCTGCTTTGATTCTTCCAA
TTTCGTACACCTACATAGCCATGATGGGCTCTCAGGGACTGACTGAAGCTTCAAAGATTGCTATCCTGAACGCGAACTACATGGCAAAGCGTCTGGAGAA
ACACTACCCAGTTCTTTTCCGTGGAGTCAATGGAACTGTTGCCCATGAATTCATCATTGATTTAAGAGGGTTCAAGGCAACTGCTGGTATTGAGCCTGAG
GATGTGGCGAAGCGCTTGATGGACTACGGATTCCATGGACCAACCATGTCATGGCCCGTTCCAGGCACACTTATGATTGAACCCACTGAAAGTGAAAGCA
AGGCTGAACTAGACAGGTTCTGTGATGCCCTTATCTCCATCAGAGAGGAAATTGCAGAGGTAGAAAATGGCAAAGCAGATGCGCACAACAATGTCCTGAA
GGGCGCTCCTCACCCACCCCAACTCCTGATGGGCGATGCATGGACTAAGCCATACTCTAGGGAGTATGCTGCGTTCCCCGCGGCGTGGCTTCGGGGTGCC
AAGTTCTGGCCAACAACATGTCGTGTGGACAACGTGTACGGGGATCGCAACCTGATCTGCACTCTGCAGCAGGCGTCCCAGGTGGCAGAGGAAGCTGCAG
CTGCCACCGCGTAATCTTCTGATGATGACGATCCTGGTGTGTGAAACAGTGTCAAGAAGTTATCATGCTTCCTGTAGGAGGGAAGCATGCTTGCTTCTAA
ATCCCTCATGTACTGTATATATTCTCCTCAAATGCCACCTTCTCATGTATCCTCTGTACCCCCCCACTGCCTCCCCATTCCCATTTGAAAGTGAAATTAG
CTATATTGGCTAGCATTTCCACTCTTCTCTGAATACAGGACAAATAATGGAGATCTGTTTTGATGTCCTAGCCATACACGGAAAGAAAATCTAGTTATTC
TCAGAT
page-top