Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1916
Contig Information
Length 1998 bp
Tissue Shoot grown with dessication
Clones 27 Clones [Download: CSV  ,  FASTA ]
whvd10c21    whvd12a02    whvd12a13    whvd12a14    whvd1k08    whvd3l15    whvd8b22    whvd13l09    whvd15d17    whvd18o17    whvd18o18    whvd19b10    whvd20d11    rwhvd10c21    rwhvd12a02    rwhvd12a13    rwhvd12a14    rwhvd1k08    rwhvd3l15    rwhvd7l16    rwhvd8b22    rwhvd15d17    rwhvd17n06    rwhvd18o17    rwhvd18o18    rwhvd19b10    rwhvd20d11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative AdoMet synthase 3 [Hordeum vulgare subsp. vulgare]
Score 1967
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1916
AACAGCACGCTGCATGCATGCTTCAGTTCATGTTCAGTCCACACTCCACACGGCCAGCATAAGTTGTACACGAAACTAACAACACACACGCGGACGGACG
ACATCTCCCTATCGCTATAAGGAACAGCAACGACGAACCTGAACTGAAGAACTATGTAACGAGGCGAGTCCGAACTCGTTATATCAAAGACTCCACATGC
ATCGACGACAGGTAGGTACGCGGGAAGCCTGGAACGCAAGGTGGAGCCGTGATGGCGGCGTTTCGTGCTCACATCTGCACCTCCCTACCATAGACCCAGC
TGAAGGGCATCTTACCGGCTTGCTTGGCCCTCGACTGGGCCCTCTCGTCTAGCTTCCGGATCCTTCCGGCGAGGGTGCAGAGGTAGTCCTGGGCCTTGTG
CCCCTCGCCGGAAAGGCCGGTCAGTTCAGGGCCTTGTGCCCTTTTTTTTGAGCATTATGAGGGAACTACACAACAAAGAATATGATAAGTGAAAGTGACA
GAGCGACTAACAGAGCAAACTGCACATAGCTCAGCAGTTTCAGCGACTCAAAATGGAAAGGATAAATATATGAAATGACAATAAGAAACTTAGCACTGAC
TACCATACAACAAGACCAGTGTAGAGCGTCGCTTCAATATCTAATGCTTCTTCTCACTTCCCAGGAGCAACATGATCCCGTCTTGACGAACTTGAGAGGC
GGCAGACCAAGAGAACGCCATGCTCTTAGGCAGATGCCTTGTCGAACTTGAGGGGCTTCACCACCTCCCAGGTGAAGTCGGCATCATCGCGGCCAAAGTG
ACCGTAAGCAGCGGTCTTGATGAACCTGTTTCCACCTTTCTTCAAGTCCAGGTTGATGCTGATCATCCCGGGCCTGAAGTCAAAGTTCTCCTTCACGAGC
TTGAGGATCTCCCTGTCGGGGATCTTGCCGGTGCCGTAGGAGTCGACGAACACAGACAAAGGCTCAGGCACACCGATGGCGTATGAGATCTGCACAATGC
AGCGGCGTGCGAGGCCGCTGGCGATGATGCTCTTGGCGGCCTGCCTGGCAATGTAGGCGCCACTGCGGTCGACCTTGGTTGGGTCCTTGCCAGAGAAGGC
ACCGCCGCCGTGGGCTCCCCAGCCACCATAGGTGTCGATGATGATCTTGCGGCCGGTGAGACCGGCGTCACCGTGAGGGCCGCCGATGACGAAGCGGCCA
GACGGGTTCAGGTGGAAGATGGTGTTCTCATCGAGGTACTTCGCGGGGATCACCGGCTTGATGACATGCTCCTTGAGGTCCGCGGCAATCTCGTCGTTGG
TGACGGTCTCGTCGTGCTGGGTGGAGATGAGGACGGTGTGCACACGAACAGGTACCATGGCACCATCCTCGTTTAGGTACTCGACAGTGACCTGGGTCTT
TCCGTCAGGCCTAACCCAGGCGCAGGTGCCATTCTTGCGGACCTCGGTGAGGCGAGCTCCGAGCTTGGTGGCAAGCACGTGGCTGAGGGGCATCAGCTCA
GGGGTCTCGTCGGTGGCATAGCCGAACATGATGCCCTGGTCACCGGCGCCGACCTCTTCGGGACGCTTGGTGAAGTGTCCGTGAACACCCTGGGCAATGT
CAGGGGACTGCTGCTCGATGTTGACGAGCACCTTGCAACGGTCGGCGTCGAGACCAACATCATCAGAGATGAAGCCGATGTTGCGGCAGGTGTCGCGCAC
GATCTTCTCGTAGTCGACGGTGGCCTTAGTGGTGATCTCGCCCAAGACCATGACCATGTTGGTCTTGGTGACAGTCTCGCAGGCAACCTTGCTGTCGGCA
TCCTGCGCCAAGCAGGCATCCAAGACGGCGTCGGAGACCTGGTCACAGAGCTTGTCGGGATGGCCCTCATTCACAGACTCGGACGTGAAGAGGAACGTCT
CGGCCGCCATTCCTTTAGTGCTAGCGGTGCCCTTGCGCTGCTTCTACTGCTCGATCGGGAGGCCGAGGAACCGAAGGAGGGAGGGAAGAGGCGGAATG
page-top