Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1912
Contig Information
Length 1680 bp
Tissue Shoot grown with dessication
Clones 25 Clones [Download: CSV  ,  FASTA ]
whvd10g05    whvd10g06    whvd2j17    whvd2k18    whvd5g13    whvd5i21    whvd6k08    whvd14g08    whvd14o23    whvd17j13    whvd17k20    whvd19h06    rwhvd10g05    rwhvd2j17    rwhvd2k18    rwhvd5g13    rwhvd5i16    rwhvd5i21    rwhvd6k08    rwhvd14g08    rwhvd14o23    rwhvd16a06    rwhvd17j13    rwhvd18i10    rwhvd19h06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0869800 [Oryza sativa (japonica cultivar-group)] >gi|15408693|dbj|BAB64099.1| putative photosystem II subunit PsbS [Oryza sativa Japonica Group] >gi|20160872|dbj|BAB89811.1| putative photosystem II subunit PsbS [Oryza sativa Japonica Group] >gi|113534460|dbj|BAF06843.1| Os01g0869800 [Oryza sativa (japonica cultivar-group)] >gi|125528521|gb|EAY76635.1| hypothetical protein OsI_04589 [Oryza sativa Indica Group] >gi|125572786|gb|EAZ14301.1| hypothetical protein OsJ_004126 [Oryza sativa (japonica cultivar-group)] >gi|215701291|dbj|BAG92715.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737433|dbj|BAG96563.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215764949|dbj|BAG86646.1| unnamed protein product [Oryza sativa Japonica Group]
Score 787
Evalue 8.93226e-83
Total Hit Count 318
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1912
TTTTTTTTTTGGATTTGCAACTGTCGGTATGCATGGCAAATTAGCTGCTAGCTCTTGTTTTTCATAAGGCAACGACCAACTTCTTACACCTAAGTACACC
CCAAGGTCTCACGTTACACAACAAACAAGCAAAGCACGGACGGACGGACGTACAATTAATGGCCAAAAAGCACTCGCGCGTGATCTAGTCGTCCTCCTCG
CCGCTGATGAACTTGCCGGTGCCGGGGTTGATGGCGGCGATGAAGAAGAAGACGACGTTGAAGAGCACGAGCGGCTCGATCTCGCTGATGGGCACCCCGG
TCTCGATGTTGAGCTGCGCCAGCGCGCCCTTGCCCGTGATGATCTCCCCGATGATGGAGAAGGCGATCCCCAGCTGCGCCAGCCGCCCCACGAACAGCTC
GTTCGACTTGGTGAACCCGAACAGCGGCCCTCCCTCGCTGAGACCGAGGGCGGAGCGGAAGCCTTTGCCGGGGGCGATGACGGCCTTGTCGAGGCCGGTG
GTGGGCTGCTCGTCGACGAACCTGCCGCGGTCTCCGAGCGCGCCGATGGCACCGAGGAGGGTAAAGAGGATGAAGAAGAGGAGGAGGGGCTCCGCCTCGT
AGATCGGGATGCCGGTCTCAAGGTTCAGCTGGGACAGGATGCCCTTGCCGGTGATGGCCTCTCCCAAGATCGATGCGGCGAAGCCAATCATGGCAACACG
GCCGACGAAGAGCTCGTTCTCCTTGGTGAAACCGATCCCGCCGGACGTGCCGAAGATACCGTCCTCGGTCTTGGGCTTGGGGGCAACGACCTTCTTGGCC
GGCGCGGCCTTGGTCTTCTTGCCGAACAGGGCCATGGTCCGGACGGAGAGGGACGGCATGTGCTTGTAGTACGCTGCCGCCGACGAGGAGGAGGAGAGCG
CGAGCCGCGAGAAGGGGCGTGGACGCCGACGACGGCCGGGGCCGCCTGCAGCAGGCTCCTGCCGGAGGCCACGCCGTTGACGCCGGACATGAGCATCGAC
TGTGCCATGGATGCCCGCCTAGACGCTCACTCGTGATGATATCGCTTCGCGCGTCTGTGGCTGTGGCTGTGGGGGTGGCCGCTCGTCCAGGTGTGGCTGT
TTTCCCTGATTGGTTTGCCTGCACAAGCACACACGATCTCTTGCATGCATCTCTTCCTCTCGACATTCAGTCTACTTTTCGCGAGCCTAACTCCAAAACC
ACATTCCCATGAATAAAGATTGTAGAACTCATAAGCCTCGTCAATAGAGTCAAAGCTTGTTCCAATACTTGGACAGAGAACAGGGCCATCCTTCTTATCA
GCATAAGCGCGCAGAGACAATTCAAGAGTTGATTTCCTATTTGGGTTCATCTCCCTTTCCTCCGGGGCTTTCCCGATCCTCACCCTCGGCCCTAGCTGCA
TCCCCGACTAGCTGTGCATCGCCGCCGGTGCCAAATGCCATGGTTGGGACGCTCATCGAATCCTGCGACTCGACTGGATAGGCGCAGTTGTTCCATGGCG
CGGGCGGAGCACACACCCCATCGAGCTCGACGCCATTGGTGGACATCTTGCTATGCTATGAAAGACGCCGCCGGCCGCACTGCCGCCGGCCGCACTGCCG
CCGCCGTACCCCAAATAGATGCAGCTGGGGATGGAGCTGGTCTCGGCGGAGCAGCACAGTCGGCCGTGGTGCAGCCAGAT
page-top