Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1881
Contig Information
Length 808 bp
Tissue Shoot grown with dessication
Clones 16 Clones [Download: CSV  ,  FASTA ]
whvd10d04    whvd5c03    whvd13n09    whvd13n10    whvd14i11    whvd14i12    whvd15e16    whvd20b15    whvd20m20    rwhvd10d04    rwhvd5c03    rwhvd8p13    rwhvd13n09    rwhvd13n10    rwhvd15e16    rwhvd20b15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit [Triticum aestivum] >gi|11990903|dbj|BAB19815.1| ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit [Triticum aestivum]
Score 798
Evalue 2.95045e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1881
GGGCATCCTCCTCTCCTCCGATAATACAATACCATGGGCCCCCGCCGTGATGGCTTCGTCGGCTACCACCGTCGCACCCTTCCAGGGGCTCAAGTCCACA
GCCGGTCTCCCCGTCAGCCGCCGCTCCAGCGGCAGCCTCGGCCGCGTCAGCAATGGCGGAAGGATCAGGTGCATGCAGGTGTGGCCGATTGAGGGCATCA
AGAAGTTCGAGACCCTGTCTTACTTGCCACCCCTCTCCACGGAGGCCCTCCTGAAGCAGGTCGACTACCTGATCCGCTCCAAGTGGGTGCCCTGCCTCGA
GTTCAGCAAGGTTGGCTTCGTCTTCCGTGAGCACAACAGCTCCTCCGGGTACTACGACGGTCGATACTGGACAATGTGGAAGCTGCCTATGTTCGGGTGC
ACCGACGCCACGCAGGTGCTCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCCTATGTCCGCGTCATCGGCTTCGACAACCTGCGCCAGGTGC
AGTGCGTCAGCTTCATCGCATTCAGGCCACCGGGTTGCGAGGAGTCTGGCAAGGCCTAAACTACGAGTTAAAACAATGGCCTATGTATGATTGTCTTTTG
TGAACTTCACTTTTGTCCAGGACTCTGCTTCCCGACCAGAGCATATTTTTCCTTCGGTATGATCTGTGTTTGTACGAACATAGGTTGTGGAGCATGCATA
TGTAAATTCTAGCACCGGCTACACATATACAACACCAGTGTGATATTTATTATATACAACAAGCGGACCATTGTCCTGCTGTTAATTCTCGGAAAACTTT
CTTTAAAA
page-top