Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1871
Contig Information
Length 1307 bp
Tissue Shoot grown with dessication
Clones 14 Clones [Download: CSV  ,  FASTA ]
whvd12o15    whvd2o05    whvd14n05    whvd16h23    whvd17i17    whvd18h13    rwhvd12o15    rwhvd1o05    rwhvd2o05    rwhvd3j19    rwhvd14n05    rwhvd16h23    rwhvd17i17    rwhvd18h13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_28383 [Oryza sativa Indica Group]
Score 1000
Evalue 2.37391e-106
Total Hit Count 188
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1871
AGCGGCCCTCTTATTTTATCATCAAACATGACATCCCGGGTAGCAAAATAACCATGTGTTATACCGCCATCTCATAACTTAACTTGGAAGGCTAATGCAA
TTCATACAACATGAAGCTACCTTCACATGAAACTATGAGTACATGATATATCGTGTACCTCCCTTTTTGGGGAATTATGCATATTTCAAGAATAATTTGG
ATGACAGTGCTAACTTCATACAAATATCATGTCTCATGAGCTATGATAAGGCGTGGGTTTGTAATCATATGCTTAGAAACTGGCATCCTCTGTTGTCGGC
CTCCTCAAGAAATAACGCAAGCTATTCGCGAGAACCTGTTGCAAAGCCTTGATTAATGGCTTGCCCCGGTAACTGACATGGAATTTTGCCTTGGCCAGTA
GCCCCTCAGTGTCAAATTCTCCAGATTGGACAGTGATATTGATGTCAGCAATGATCTTAACTAGATCAACCAACAACCCTGGACGGTCAGCTGATTCCAC
AACAAGTAAACTTCTTTCAGGACCATCGTCATAGATCTCTATGTGAGTTGCTATGTCCACATCAACCACTTCTGTAGGGGGCTCTAGCCCAAAAGTTGCA
CCCATGGCCAATTGACTGCTAGCTTCAGGATGATACTCAAGCATGTTGTTTATAATTGTCAGTCTTACTGCTTCTAACAACTCTGGGTCATCAATTTTGC
GACCAGTTGACGACTTTGTTATAGCGAACTTATTGTGTTTGCCAGAAGAATCGAGGCAAACACTAGCTTTCACAACATTTAGCCCTAAATTCCTCAAGGC
ACTCATAGTATCAAGGAGATCCCCAAGACGGTCACCCAAGGTTACTTCCACAATAGTTGCATCTGGATCTGAGTCTTGATCTATTATAACTTTCGGTGTA
GGGACTGTATTACTGTTGCTAGAGCTCCCATTCTCAACAGCTGCAGGCGAAGCAGCTCTAGGAACCCTCAAAGCTGGAGACAATAATCTCAGCTTAGCGG
GCGCTGCCGGTGCAAGTGGCCGCCACCCGGCAAGCGGATGGTTCCCGGACGCCGCCGGAAATACGCCGGAACAGGTACGGAGGGTCCCGGCGGCTACGGC
GACGGCCGATTTCTGGAATCTTCTCCCCCACTCGGCCAAGAAACGTGCGAGGATTGGGATCAAATCTTGTCAAATAAACCCGGGGGTGAGGTGGGGGAGG
GGAGATGGTGCTACAAAGGAGAGGGCGCTGATGGGATCATAGCGAGGATATCTATGGCTGTCGCGGCGGCTCTATCCATAGGATAGAGAGGTGGAAACGG
GAGGTTG
page-top