Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1868
Contig Information
Length 855 bp
Tissue Shoot grown with dessication
Clones 14 Clones [Download: CSV  ,  FASTA ]
whvd10b22    whvd10f14    whvd11e01    whvd13i08    whvd18h18    whvd20l08    whvd20l19    rwhvd10b22    rwhvd10f14    rwhvd8f09    rwhvd13i08    rwhvd18h18    rwhvd19g05    rwhvd20l08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cyclophilin A-1 [Triticum aestivum] >gi|13925737|gb|AAK49428.1|AF262984_1 cyclophilin A-3 [Triticum aestivum] >gi|156193317|gb|ABU56010.1| cyclophilin 5 [Dasypyrum villosum]
Score 843
Evalue 1.99593e-88
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1868
AAGGTAATCCCAATCCCCACAGAAATCCCCATCTCAAAACCCTAGCCCTCATCCCCGATCCCGGCGAGCGAGATGGCCAACCCGAGGGTGTTCTTCGACA
TGACCGTCGGCGGCGCGCCGGCCGGGCGCATCGTGATGGAGCTGTACAAGGACGCGGTGCCGCGGACGGTGGAGAACTTCCGCGCGCTGTGCACCGGCGA
GAAGGGCGTCGGCAAGAGCGGCAAGCCGCTGCACTACAAGGGCAGCGCCTTCCACCGCGTGATCCCCGACTTCATGTGCCAGGGCGGCGACTTCACCCGG
GGCAACGGCACCGGCGGCGAGTCCATCTACGGCGAGAAGTTCGCCGACGAGAAGTTCGTCCACAAGCACACCAAGCCCGGGATCCTCTCCATGGCCAACG
CGGGGCCCAACACCAACGGCTCCCAGTTCTTCATCTGCACCGTCCCCTGCAATTGGCTCGACGGCAAGCACGTGGTCTTCGGCGAGGTCGTCGAGGGCAT
GGACGTCGTCAAGAACATCGAGAAGGTGGGCTCCCGCAGCGGCACCTGCTCCAAGCAGGTGGTCATCGCCGACTGCGGCCAGCTCTAGATCCGCCCGCGC
GCGGGTCGCCTTTCGCCGTCGTCGTCGCCGCCCCGTGTGTCCCGTGTCGTGTCGTCGATCTAAATAAGAGAGTCGTGTGTCGTGTCGTGTCTTCCCCTGG
TCCGTCCGATGAGATCTCCGTGGTTGGTTTAGGAGGGTTTTAGGTGGACTCTTTGGGCTGCTGGATCTCTGTCCGGCCGCCTTGGTTATCTTCCTGTGTC
TGCTGCTATCTTACCGTTTGAATGAGATGAACTCCGCTATGAATTAAAAAAAAAA
page-top