Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1862
Contig Information
Length 851 bp
Tissue Shoot grown with dessication
Clones 14 Clones [Download: CSV  ,  FASTA ]
whvd10j24    whvd10n16    whvd2h24    whvd6i23    whvd6i24    whvd9p05    whvd13d20    rwhvd10j24    rwhvd10n16    rwhvd2h24    rwhvd6i23    rwhvd6i24    rwhvd9p05    rwhvd13d20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0589800 [Oryza sativa (japonica cultivar-group)] >gi|113532977|dbj|BAF05360.1| Os01g0589800 [Oryza sativa (japonica cultivar-group)]
Score 357
Evalue 6.2486e-44
Total Hit Count 241
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1862
ACGGCCAGGCCGGTGTGTGTCCAAACCTTCTCCACGCGTTCCCTCCTTCCCTCTCACTCTCTTCCCCTCCGTCTCTCTGTTCCTTCCTGCCTTCCAAGAG
ACAATCAAGAACGCCAGGCAGCTCAAACCAAGCAATGTCTTTGGCACCTTCCATCCCTTCCATCAAGGTGAAGGTGGGACGCATCGCCCCGCCGCCTCCG
TACCGGGCATGCAAGTCGTTCGCCGTGATCAGGAGCTCCAAGGCCGAGGGGCCCAGGAGACCCACGGCGCCTCCACTGTCGCCGCCCCCGCCTATGCCTC
CCAAGACGCCAGCCCTGTCCACCCCTCCGAGCCTGTCCCAGCCACCGACCCCAGTGAAGCCAGCACAGCCATCACCTCCTCCTCCCGAGACCAAACCGGC
AGTGGCTGCCGCTGCGACGCCACCGGTGGGAGGGGTTGTGACGTTCGAGTACCAGAGGAAGGTGGCCAAGGAGCTACAGGAATACTTCAAGAAGAAGAAG
CTGGAGGAGACCAACCAGGGACCCTTCTTTGGGTGGTTGGCCAAGAATGAGATTGCCAATGGAAGATGGGCTATGTTTGGGTTTGCAGTGGGGATGCTAA
CAGAGTACGCAACAGGCTCGGATTTCGTTGAGCAAATGAAGATCCTTCTCTCCAATTTTGGGATTGTGGATTTGGATTGATGGCTCATGTTTGGCGGTGT
TGTTCTGTATTTCTATAAGTCTGAAGTATAATCTATCTTCTTTCATGTATAGAAAGATCAATCCTGCACACTATTATATCCTTGAGTTTCATTTGTGCTG
TCCTGTCAGTTTTGACGAATGTAAAATCCAATTTCCAGCTTAAAAAAAAAA
page-top