Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1856
Contig Information
Length 1256 bp
Tissue Shoot grown with dessication
Clones 13 Clones [Download: CSV  ,  FASTA ]
whvd10f15    whvd11c07    whvd11n22    whvd4j13    whvd7h14    whvd8m22    rwhvd10f15    rwhvd10o20    rwhvd11c07    rwhvd11n22    rwhvd4j13    rwhvd7h14    rwhvd8m22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Cell division protease ftsH homolog 2, chloroplastic; Short=OsFtsH2; Flags: Precursor >gi|52075838|dbj|BAD45446.1| putative FtsH-like protein Pftf precursor [Oryza sativa Japonica Group] >gi|125556417|gb|EAZ02023.1| hypothetical protein OsI_24055 [Oryza sativa Indica Group] >gi|125598182|gb|EAZ37962.1| hypothetical protein OsJ_021445 [Oryza sativa (japonica cultivar-group)]
Score 905
Evalue 8.58014e-174
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1856
TACCGCGAGTGAGTTACATTACATGCCGTGCCTCGAGTAGGAATTAGTGTACATCCAAGAAATATGAACATCTTACAACAACAACAAATTCTCCAACCCT
ATAAATGCGGGCGAACCTAGACCGGGACGGCCGCCTGGGGCGTCGGGGGCACCCGGTTCTCGACGGGGATCTCGGTGAACTCGGACAGGATGGCCCGGAA
CTCGTCGCCGCTCAGCGTCTCCTTCTCCAGGAGCACCTCCACGATCTTGTCCATGGCCACGCGGTTGTCCCTCACCTGTTGCAGGGCGATCTGGTAGGCC
TGGTCCGACAGCTGCTTCACCGCCGAGTCGATGTCCAGCGCCAGCTTCTCCGACATGGAGTTCCGAGCCATCATCCGCATGATCACGTCCCCGCTCTGCG
CCGCGTCCATCAGAGACCACGGGCCGATGTCCGACATGCCAAATGTCACCACCATCTGCTTGGCTAAGCCAGTGATCTGCTGCAGGTCACCAGCAGCTCC
AGTGGTCACCTCAGAATCTCCGAATATGATCTCCTCAGCAGCTCTGCCGCCAAGGCCGCCGACTATTCTGGCGAAGAGCTGCTGCCTAGAGATGAGCGTT
GGGTCATCCATGGGAATGAACCAGGTGAGACCACGGGCTTGACCCCTTGGAACTAAGGTAACCTTCTGGACGGGGTCGTGGCCAGGCGTCAAAGTTCCGC
AAACTGCATGCCCAACTTCGTGGGTAAGCAACAAGGCTTTTGCTCTTCCCATCTGTCATGACAGTTCCTTCCATACCAGCCACTATTCTGTCGATTGAAT
CATCAATCTCCTTCGAGGAAATTCCGGTCCTCCCACGTCGGCCTGCTAATATGGCTGCCTCATTCAGAAGATTCGCCAGGTCTGCTCCACTGAACCCAGG
TGTTCTCATTGCAATGACCTCAAGGGAAACATCAGCATCGAACTTCTTGTTGCTACCGTGCACCTTGAGAATCTCTGTCCTTCCACGTACATCAGGAACA
TCAACACTCACCTGTCTGTCAAAGCGTCCAGGTCTAAGCAAAGCGGAATCCAAGATGTCAGCCCTGTTGGTGGCAGCAACAACAATGATGCCAGTGTTGC
CCTCAAAACCATCCATCTCAGTCAGTAGCTGATTGAGAGTCTGCTCCCTTTCATCGTTCCCACCACCGATACCTGTTCCTCTTTGCCTCCCAACAGCATC
AATTTCATCAACGAACACTATGCAAGGAGCATTCTCCTTGGCCTTCTTGAAGAGAT
page-top