Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1846
Contig Information
Length 1200 bp
Tissue Shoot grown with dessication
Clones 12 Clones [Download: CSV  ,  FASTA ]
whvd10a13    whvd2d20    whvd3n03    whvd3n04    whvd17i20    rwhvd10a13    rwhvd10a14    rwhvd2d20    rwhvd3n03    rwhvd3n04    rwhvd3n16    rwhvd17i20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ferredoxin-dependent glutamate synthase precursor [Oryza sativa]
Score 1246
Evalue 6.2774e-135
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1846
TTTTTTTTTTCCTACTTCATCATAAACTTTACTTATTCTGTACTGAACTACAGCACATGCAACTCGCATGCCTAACACAGGACGGGTATAAATATAAGAA
CTAATGTGTGCAGAACAAAAAATATAATTACACAGGCGAAGCCAGGAATCATGTACAAGAAAGCAGCAGTTCAACAGGGGCCGGGCCTTGCAGCCTAGCG
TCAGCGAACCAATTTACAGGGGTGGTTGGTTACCTAGGCTGCAAGAGCGTGCAGAAGAATCCTCGACGGTATCTGCAAGCTCGTTTCCAGAAGATGCCTT
GGACAGAGCTTCCACAAAATTGCAGCCTTTGGTGACGTTAGTGCTTCAGAAGGACCGCGGTCTGAGAAAATCACTTTCAAGTATCGCAGTAAGAACGCTT
TCCCTCCGTTTAGCTTTGGTCATTTTGGCGATTGGGCTTTGGCTAGTATCACTTAGCAGATTGTACTGCCGTTTTTTGCCTGGCAAGTACTCTCTCAAAC
TCGGCACAAGCTTCAGGCGAGTCTTCTTCGCTGGGTGGCACCAACTGCCAGAAGAGTGGCAGATATGCCTCCCATTCGCTCAGAATTTTAGCGCCTTTTG
TGCTGCCTGTTTTTTCAACATAGGCCTCAATCAAGCCCTTGAGCTGCATCTGCCCAGCGGGAGCATTCACTCTCTGCATCTTGACAATCTCCTTGTTTAC
CTTCGGGACTAGAGTATCATCTTCATCTAACATGTAGGCTAGGCCACCGGTCATTCCGGCTGCAACGTTTCTTCCAACTTTGCCGAGTACAACTACACAT
CCACCGGTCATGTACTCGCAGCAATGATCTCCTGTGCCCTCAACCACTGCTTGCCCAAGAGAATTCCGAACTGCAAATCTTTCTCCTGTCTTGCCTCTCA
CAAATACTTGACCACCCGTAGCTCCATACAGACAAGTGTTCCCAACTATAGCAGCATCCTCAGGAACAAATCCTGTATCATCTACAGGAACTACAACCAG
CTCTCCACCAGCCATACCCTTTCCCACATAATCGTTGGCCTCTCCTACTAGGCGAACATTCATGCCAGGTGTCAGAAAACAACCAAAGGACTGCCCTGCA
CTTCCGGTGAACGTAATGTTCAGCTGGCCTGCAAAGCCTGTATCTCCGTACTTCTTAGCAATGGCACCCGCTACACGGCCGCAAACAGCCCTATCAACAT
page-top