Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1821
Contig Information
Length 978 bp
Tissue Shoot grown with dessication
Clones 10 Clones [Download: CSV  ,  FASTA ]
whvd10e21    whvd1c15    whvd15n15    whvd17b10    whvd20p19    rwhvd1c15    rwhvd15n15    rwhvd17b10    rwhvd20p19    rwhvd20p20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Unknown (protein for IMAGE:5194336) [Homo sapiens] >gi|111494016|gb|AAI11385.1| Unknown (protein for IMAGE:5198300) [Homo sapiens]
Score 1340
Evalue 5.78736e-146
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1821
CGCTCATTCTTGGAGAACAGAATACAGAATACGTAGGACCTCCATCGATCAGAATGGCCGCAACCACCATGTCACTCTCTTCTCCAGCCTTTGCCGGCAA
GGCAGTGAAGAACTTGCCATCATCTTCTCTTTTCGGGGATGCCCGCGTCACCATGCGCAAGACAGCGGCAAAGGCCAAGCAGGTTGCCTCTGGCAGCCCG
TGGTATGGCTCTGACCGCGTGCTCTACCTCGGCCCACTTTCTGGTGAGCCCCCGAGCTACCTCACTGGTGAGTTCCCTGGCGACTACGGCTGGGACACCG
CTGGGCTGTCGGCCGATCCCGAGACCTTTGCCAAGAACCGTGAGCTGGAGGTGATCCACTGCCGTTGGGCCATGCTTGGCGCACTCGGTTGTGTCTTCCC
CGAGCTGCTTGCCCGCAACGGTGTGAAGTTCGGCGAGGCTGTTTGGTTCAAGGCCGGTTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTCGGCAAC
CCAAGCCTTGTGCACGCCCAGAGTATCCTTGCCATCTGGGCTTGTCAGGTTGTGCTCATGGGCGCTGTCGAGGGCTACCGCATTGCCGGTGGACCGCTCG
GTGAGATTGTTGACCCGCTCTACCCGGGCAGTAGCTTCGACCCACTCGGCCTTGCCGACGACCCTGAGGCATTCGCCGAGCTCAAGGTTAAGGAGATCAA
GAATGGTCGCCTTGCCATGTTCTCCATGTTTGGTTTTTTTGTGCAAGCCATCGTCACCGGTAAGGGTCCACTCGAAAACCTCGCTGACCACCTCACCGAC
CCCGTCAACAACAACGCTTGGGCATTTGCCACCAACTTCGTTCCCGGCAAGTAAGGTGTGTGTGCGCGCACGCTTGCGGTGAAGTGTTTTGTTAGCTGTT
TGAGTTGTACTACCATGATGTAAATTACGAGGATTTGATTATCTGAAAAAATTGTGAGGTTTCTGTGCAAAAAAAAAA
page-top