Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1816
Contig Information
Length 1335 bp
Tissue Shoot grown with dessication
Clones 10 Clones [Download: CSV  ,  FASTA ]
whvd2m17    whvd4i08    whvd7c13    whvd15l21    whvd15l22    rwhvd2m17    rwhvd4i08    rwhvd7c13    rwhvd15l21    rwhvd15l22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit papain-like cysteine proteinase [Hordeum vulgare subsp. vulgare]
Score 1574
Evalue 6.7724e-173
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1816
GCGGACATGGCTTTCATGCGCTCGTCGTCCTCATCCATGGCTCTGGCTCTGCTGCCGCTACTGGTGGCAGCCGCATTCTTCATCCCCTCCATGGCTTCAT
CAGCTTCAGGTACCCTGGACCATGGCTTGGATGGTGAGGCACTGCTGATGCTGGGGAGGTTCCATGGGTGGATGGCGGCGCACGGTCGGTCGTACGCCAC
CGTGGAGGAGAAGCTGCACCGGTTTGAGGTGTACCGGAGCAACATGGAGTTCATCGAGGCGGCGAATCGGGACAGCCGGATGAGCTACAGCCTCGGCGAG
ACCCCGTTCACCGACCTCACCCACGACGAGTTCATGGCCATGTACAGCAGCAACGACGAGTCGTCATGGGAGTCGGAGGAGATGACGGTGATCACAACTC
GCGCTGGCCCCGTCCACGAGGGCACCGCCGCCGTCGAAGAGCCACCTCGTCATACCAATACCAATCTGACGGCGGTGGTGCCTGCGAGCGTCGATTGGAG
GGAGAAAGGCGTCGTCACAGCAGCCAAGTATCAAGGGGAATCCTGTTCGTCTTGCTGGGCGTTCACGTCGGTGGCGACGATGGAGAGCGCGCATGCGATC
AGCACGGGCGGATCGCCACCGGTGCTGTCGGAGCAGCAGCTGGTGGACTGTCGGATTAACGGCTGCGGCAACAGTTGGATGGACAAGGCCTTCGAGTGGG
TGATCCAGAACGGTGGCATCACCACGGAGGCGGCCTACCCCTACACCGGCAAGGTGGGCACGTGCCAAAGGGCCAAGCCGGTCGCGGTGAAGCTCAGAGG
CTACAAGAAGATTTCACCACCCGGTGACGAGGCGGCGCTGATGGCGGCCGTGGCGCAGCAGCCCGTCGCCGCATCCTTCGACTACAGTGACCCCTGCTTC
CAGCACTACATCCGCGGCGTGTACAACGCCGGTTGCTCCAGGTCGGGCGTGTACAACAAAGGGGCGTGCGGGACAACGCAGAACCACGCGCTGGCCATCG
TCGGGTACGGGACCAAGCCTGACGGGACCAAGTACTGGATTGGCAAGAACTCGTGGACTGACCAGTGGGGCGACAAAGGCTTCGTCTATTTCCTTAGGGA
CTCGCCACCCTTGGGCTTGTGCGGCATTGCCAAGTACCCGCTTTACCCTATCATCTGATGATCCAGCCGCCGTGCACCTCCATCATCTTTGTGTGACTCC
GTGCATCTCTACTTATATTATATATATGTAATGAATAATTGCACGGTACCTAGCTATTCAATTGTCTACTCCATGTCTATGCTATGCATGTAAAGGTTCG
GGTGCTACACATGCATCCTTGCCTATAATAAATAA
page-top