Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1823
Contig Information
Length 788 bp
Tissue Shoot grown with dessication
Clones 10 Clones [Download: CSV  ,  FASTA ]
whvd10b12    whvd10b23    whvd5l20    whvd16b17    whvd18d09    rwhvd10b12    rwhvd10b23    rwhvd5l20    rwhvd16b17    rwhvd18d09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PW9, chloroplastic; Short=RuBisCO small subunit PW9; Flags: Precursor >gi|170771|gb|AAA34302.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 867
Evalue 2.82707e-91
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1823
ATCGCCTCCCCACCTAGCAATTCACGTACTCCGCCATGGCTCCCGCCATGATGGCTTCCTCCGCCACCACCGTCGCGCCCTTCCAGGGGCTCAAGTCGAC
CGCGGGCCTCCCCGTCAGCCGCCGCTCCGGCAGCGCCGGCCTCAGCAGCGTCAGCAATGGCGGAAGGATAAGATGCATGCAGGTGTGGCCAATTGAGGGC
ATCAAGAAGTTCGAGACCCTGTCTTACTTGCCACCCCTCTCTACGGAGGCCCTCCTAAAGCAGGTCGACTACTTGATCCGCTCCAAGTGGGTACCCTGCC
TCGAGTTCAGCAAGGTTGGCTTCGTCTTCCGTGAGCACAACAGCTCCCCCGGGTACTACGACGGTCGATACTGGACAATGTGGAAGCTGCCTATGTTCGG
CTGCACCGATGCCACACAGGTGCTCAACGAGGTCGAGGAGGTTAAGAAGGAGTACCCTGATGCCTATGTCCGCGTCATCGGCTTCGACAACATGCGCCAG
GTGCAATGCGTCAGCTTCATTGCCTTCAGGCCACCAGGTTGCGAGGAATCCGGCAAGGCCTAAAGTGCAAGTTGAAGTAACCGATATACATGTCATGTTA
GTCACATTTGTCGGCGGCTCTGCTTTCTCAGTTTTACTTCTCGTTCTACTCATATATATGTGAATATATGAGCATATGTATGTAAGCACCTACCAATGTA
GGTCGAGGAGGATGCATATGAGAATTATAGCACCGGCTATACATATACATATATATTATATGCAATCAACGCATTAGTGTCTGCCATC
page-top