Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1814
Contig Information
Length 862 bp
Tissue Shoot grown with dessication
Clones 10 Clones [Download: CSV  ,  FASTA ]
whvd10a20    whvd6l22    whvd9h17    whvd16b21    whvd17e01    rwhvd10a20    rwhvd6l22    rwhvd9h17    rwhvd16b21    rwhvd17e01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0913000 [Oryza sativa (japonica cultivar-group)] >gi|20161376|dbj|BAB90300.1| putative thioredoxin F [Oryza sativa Japonica Group] >gi|113534698|dbj|BAF07081.1| Os01g0913000 [Oryza sativa (japonica cultivar-group)] >gi|125528816|gb|EAY76930.1| hypothetical protein OsI_04888 [Oryza sativa Indica Group] >gi|125573075|gb|EAZ14590.1| hypothetical protein OsJ_004415 [Oryza sativa (japonica cultivar-group)] >gi|215715230|dbj|BAG94981.1| unnamed protein product [Oryza sativa Japonica Group]
Score 606
Evalue 6.09135e-61
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1814
AGAAAACACCGCTCTGCACACCACCAATTCACACCACCCGTTGGGGGCGTTACCTTCCAAAACTCCTGCAGCCAATGGCGTTACGCCTCTCCGTCTCCTC
GCCGCAGAGCACGGCCTCCTCGCCGGCCATCTCCTCATGCCGCCCCGCCGCCTGCGGCCGCTTCCTGGCCTGCGTGGCCGCTTCTCAGAAGAGGAGCCTG
ATGGCGGTGTCCGGCTCTGATGGGAGGGGAGTGGCTCCGGTGAAGTCGGGCGGCTTGGAGACGGCCACGACGGGAGCCGACGAGGTGGAAGCGCCCACAG
CGGCGGTGGCGGTGACCGGGCAGGTCACGGAGGTCTGCAAGGACACCTTCTGGCCAATTGTCAAGGCAGCAGGGGAGAAGCCCGTCGTCCTCGACATGTA
CACCCAATGGTGCGGCCCTTGCAAAGTTATGGCACCAAAATTCCAGGAGATGTCTGAGAAGGACCACGACGTCGTATTCCTCAAGCTCGATTGCAATCAA
GACAACAGGCCTCTTGCAAAGGAGCTTGGCATAAGGGTTGTACCAACATTCAAGATTTTCAAGGATGGGAAGGTTGCAAAGGAGGTCACTGGTGCGAAGA
TTGATGAATTAGCACGTGCGATTGAGGAAGTGAAGTCAAGCTGAGCAATTCCCTGGAAAGAAATGCACCAGTTAGCATGCTATCACTAGTGTACACTATG
GGATGAAAACAGCCTTTGTGGAAGTGGATAATCACCGTGGAGAAAAACAGTTATTATAGTTCTTCTGCTTATGATGATTTACCAATCGTTCTGGACAATA
TACACCCATCCATGTGGAGTGTATGCTGTAAATAGTCATTTAAATCTTTCTGAAAAAAAAAA
page-top