Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1810
Contig Information
Length 1803 bp
Tissue Shoot grown with dessication
Clones 9 Clones [Download: CSV  ,  FASTA ]
whvd10e20    whvd10p07    whvd10p08    whvd11f21    whvd8g24    rwhvd10e20    rwhvd10p07    rwhvd10p08    rwhvd8g24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0357000 [Oryza sativa (japonica cultivar-group)] >gi|38637503|dbj|BAD03757.1| putative wound inductive gene [Oryza sativa Japonica Group] >gi|113623593|dbj|BAF23538.1| Os08g0357000 [Oryza sativa (japonica cultivar-group)] >gi|164375539|gb|ABY52937.1| putative wound responsive protein [Oryza sativa Japonica Group] >gi|215740930|dbj|BAG97425.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1470
Evalue 1.1468e-160
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1810
AGTTTGTTGAAGATGGGGAAGAGAGAATAGTAGTTGGTAGTTTAGACCTGAATCAGTGCCTCTGGCTACCAGATGAACTGACTGGAAAGAGGCCAGGGGT
AACTGAATCAAGTCATACACGGGCATATCTAAGCAATGTATGTGTTGCCAAGGAGCTCCAAAGATGCGGACTGGGCTATGCATTGGTTGACAAGTCTAAG
AAGCTTGCTCGTCAATGGGGCATAACGGATTTGTATGTCCATGTTGCCATCAACAACGAGGCGGCACAAAAGCTGTACATCAAGAGTGGATTTGTGTACG
AAAGTGAGGAGCCTGCCCAGCAGGCTAGGCATCTTGGGCGCCCTCGAAGGCTTCTTCTTTGGCTTGATATGAAGAACGAAACCTTGTGATCTTACCTGTA
AATGCTTCCTTTTATAGTTATACAGTATTATCTATATATAATTTGATTTTACTGCCCAATTCAAGTAGTAGTATTTTTTTTCCTTGTGGAAAGAAATACA
ATTCTGAAAATTTAAATTAAGGATTCTCCCTCGATTCCGAGGAACGGCCGTTGCTGTTGGCACATTGATGGCAATGGAGGGACCAATTCTTTGTCGCCCT
ATAATGCAAGCAAGGCTTCCTGCTGCCCTTGTCAACAACTCATTGATCAAATCTGGGCAGCTTGGCACTGCATTCTTGGGTGCTGTGTCTAAATACCGCA
ACATTACTAGACTAGTTTCTCCAATCTCTCAGTCATCTTCAAAGAACTTTGGTCCTATTTGTCGTAGCTTCAGCTCCTCATCTGATGGTAATGGATACAT
GGCTGGAAACTTCAATGAGAATGATGAAGATTATGTTAATTCCACTGTGCTTGAAGCTGTTGAGGTCAGAAGTGGATCAGAAGGATATATAGTAAAGATG
CGAGATGGGAAAAACCTGCGGTGTGTGCATAATAATTCTCAAGGGAGAGAGATTCCAGAGAGTGCACCACAACCTGCTATCGTTTTGAGAATTGAAGATG
GAAGTGGAACTTTACTTCCAATCATTGTTTTGGAGATGCCAAGTGTACTTCTGATGGCTGCTATTCGCCATGTTCATATTGCAAGACCTACCATATATCA
AGTTGTTAAGGAACTGATCGATAAGATGGGCTATGAGGTAAAACTTGTTCGGGTAAACAAAAGAATTCAAGAAGCATACTGTGCCGAGCTTTATCTAACA
AAGATTGGAGATCAAACAGAGAGTATAACATTTGATCTTCGGCCTTCGGATGCTATCAATATTGCTGTTCGCTGCAAGGTTCCTATACAAGTACATAGGA
GTCTTGCATACAGCGACGGCATAAGATCAGTCGAGCCAGCAAAATTGGTGGCTGCAGGTGGCCTTTCAGATGGTTTATTGTTTACTGAACTTGACAGACC
TGATGGAGAGCCCTGCGTTGAAGCTCAAGAGTTCAGTTTGGTGCGAAACATGTTCATTGCAGTTGTTGAAGAGAGATACAAAGATGCAGCAACATGGAAG
GACAAACTAATGAGGCTGAGATCTAAGCGGAAGAACTGGGCCTGAAAGGTTCTTAACTCGGTACTCTATTTGTATCATATTGTCGTCCCTTTGTAGACCT
GTGATTACCCCCCGCCCCGCAATAGACTGGTCACTTTGGACTGTGTAAATAAAAAAGTGTCCTCAACCTCACTATGCAATGGAGATGATTGGTCCGTATG
GTTTGATGTAATTAGACGTATATATTCCAAGGCCCTGAGAAGTAGCTTCTGTAAATTCAGACTAATATTCAGAAAGTAAGAACTAATCTATGTAAAAAAA
AAA
page-top