Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1804
Contig Information
Length 1001 bp
Tissue Shoot grown with dessication
Clones 9 Clones [Download: CSV  ,  FASTA ]
whvd10b07    whvd10b09    whvd10l19    whvd19l09    whvd19l10    rwhvd10b07    rwhvd10b09    rwhvd10l19    rwhvd9g24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0556800 [Oryza sativa (japonica cultivar-group)] >gi|46389866|dbj|BAD15467.1| proline-rich family protein-like [Oryza sativa Japonica Group] >gi|113536664|dbj|BAF09047.1| Os02g0556800 [Oryza sativa (japonica cultivar-group)] >gi|125539889|gb|EAY86284.1| hypothetical protein OsI_07655 [Oryza sativa Indica Group] >gi|215712358|dbj|BAG94485.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765806|dbj|BAG87503.1| unnamed protein product [Oryza sativa Japonica Group]
Score 573
Evalue 5.23751e-57
Total Hit Count 173
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1804
TCGTTTTCTGGTGTGTGTGTGTGTAAGGCTAGAGCAAGCGAGCGAGCGAGAGAGACTGAGAGAATTGAGAGAAGATGAAGATGGCTTGCTCTGCCCAATC
CATGCTCTCCGCAAGCAGCTGCGTGCTCCTCAGGAGCAGCAAGCCCCAGCAGGCCACGATTCCGCGAGGAGGAGGGGGCATCACCGGCGGCAACAGGTTC
TTGACGCTGTCCTGCAATGCTTCTTCGTCTCCGGACGACTCCGAGTGCAACGACGTGGAGTGCGCCCCGGAGAAGGAGGTCGGGAGCCTGAGCGTGGAGT
GGCTGGCGGAGGAGAGGACCAAGGTCGTGGGGACCTTCCCTCCCAAGAAGAAAGGATGGACCGGCCTCGTCGAGAAGGACACCGCCGGCCAGACCAACAT
CTACTCCATCGAGCCGGCGGTGTACGTGGCGGAGAGCGCCATCAGCTCCGGCACGGCGGGGACGTCGTCCGATGGGTCCGAGAACACGGCGGCGCTCACG
GGAGGGCTGGCCCTCATCTTCGTCGCCGGGGCGGCCTCCATCCTCATCCAGGTGAGCAAGAACCAGCCGCCCGTGCAGACCCAATACTCCGGCCCGCCTC
TCAGCTACTACGTCGCCAAGTTCCAGCCGGCCGCCGCGGCATTCTCGGTCCAGTCGAGCCCCCCTGTCGTGGAAGCGGCCGCGCCCGAGGAGACGCCTTC
TGAATCTGATTCACCCACCTTAGAGGCGGAAACTTCGGCAACCGCGGAGCAGCCGTCGTCGTGAGCTGATAATCATATACACGGTGAGCGTGAGACGGAA
ATAATCGAAGCATAAATTTGATGTGGAAGACAGGCACGAGCTTTTGTATTAGCAATTCGATACAACGCTAGAGTTTGAAGAGTTTGACACGCCGTTCTTC
ACTCATGAGTGAAGTCTACTCTTTATTTTGTACACGCGGTCTATGCCGGGTGGTTCGCTTGGTGTTCANTTACTTATCTTGCATACCANTTGCAATCATG
T
page-top