Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1795
Contig Information
Length 1166 bp
Tissue Shoot grown with dessication
Clones 9 Clones [Download: CSV  ,  FASTA ]
whvd12b20    whvd12b24    whvd4c08    whvd7j14    rwhvd12b20    rwhvd12b24    rwhvd4c08    rwhvd7j14    rwhvd9a02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ClpC [Arabidopsis thaliana]
Score 1046
Evalue 5.25798e-147
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1795
TGATCAATCAAGAGCCAAAGCCAGCAATGTTTCCTTTCCCCTTAAATTATATATGCATATTACTGTATATTTTATACATACAGTTATAGAATTATATACA
CCTGACCTGACTGCCGCACCTATGAAGAGATATGTGCTGGAAGGAAATGAAAACGCTGTATTGTATATATATGCTTAACAATCTTCTACGTATTCTATAC
AGTACCAACAACTAAACAGCGACCGCCGGGGTTGGAAGCTCCGGCAGTCCGCTCTCGCCATTCAGCACAATGACTTTCCCCTCCGGGTCCACATCAACGA
TGACAGAGTCGCCCTCCTTGACCTCCCCGCCCAAAATCTTCTCCGCGAGGCTGTCCTCCAGGAGCCTCATGATGGCCCTCCTCAGCGGCCGCGCTCCGTA
GCTAGGGTTGTACCCTTCGTCCACGACCCGCTCCTTGAACTTCTCCGTCACCTGCAGGTTGATGTCCTTGGTCTTGAGCCTGGTGAAAACCTCCTGCAGC
ATTATGTCCGCGATCTCTTTGACTTCCAGCTTGGTCAGCTGTCTGAAGACGATCATCTCGTCCAGACGGTTGAGAAACTCTGGTCGGAAGTACTGCTTCA
TCTCCTCGATCACCAAGCTCTTGATCCTGCCATAGCTGCTGTCCTTCTCGTCCGAGTCGAGGTCGAACCCGATCTTCCTCCCCCCCTTCTCAATCACGCT
GCTCCCAACATTTGATGTCATTATCAGGAGCGTGTTCTTGAAGTCCACTGTTCTCCCCTTGCTGTCGGTTAACCTTCCGTCTTCCAGGATCTGGAGCATC
ATGTTGAACACATCCGGATGTGCCTTCTCAATCTCATCAAAAAGCACAACGCTGTATGGCCGCCGTCGAACCGCCTCCGTCAGCTGCCCACCTTCAGTGT
ATCCCACATAGCCTGGTGGTGAACCGATCAACTTGGACACAGGTGTGCCTCTCCATGAACTCACTCATATCCAGCCGGATCATGGCTTCTTCAGAGCCGA
AGTAATATGATGCCAGAGTCTTTGCAAGCTCTGATTTCCCAACACCAGTGGGACCTGCAAAAATGAAGCTCGCAATTGGTCTGTTGGGGCTCTTGAGGCC
CACACGAGCACGGCGAACAGACCGACTTATTGCTTTCACAGCCTCGTCTTGGCCGATGACACGCTT
page-top