Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1785
Contig Information
Length 581 bp
Tissue Shoot grown with dessication
Clones 8 Clones [Download: CSV  ,  FASTA ]
whvd10a18    whvd8l02    whvd8l13    whvd9k01    rwhvd10a18    rwhvd8l02    rwhvd8l13    rwhvd14e13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cysteine proteinase inhibitor [Triticum aestivum]
Score 622
Evalue 3.69649e-63
Total Hit Count 319
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1785
GGGTCGTAGGATCGGTGGCCGCCCTGCTCTTGCTACTCGCCATCGTCGTGCCGTTTACTCAGACCCGGACGCAGAGCGCACGGGACAAGGCTGCCATGGC
GGAAGACGCGGGGCCGTTGGTGGGAGGCATCAAGGACTCGCCGATGGGCCAGGAGAACGACCTCGACGTCATCGCGCTCGCCCGCTTCGCCGTCTCCGAG
CACAACAACAAGGCCAATGCCCTGCTGGAGTTCGAGAATGTGGTGAAGCTGAAGAAGCAAACTGTTGCTGGCACGATGCACTACATTACAATTCGGGTCA
CTGAAGGTGGGGCCAAGAAGCTCTATGAAGCTAAGGTGTGGGAGAAACCATGGGAGAACTTTAAGCAGCTCCAGGAGTTCAAGCCGGTGGAGGACGCTGC
AATCGCATGAGGCGCGCCCCAGCTTTGCAAGGATCTGCAGCTATGGTGTTGATGCAGCTATCAATCGGACATGGTTTAGCGTGTTCTCGTGTAATATCAA
GAATAAGTCCGCTTCTTGCAAGTTGTTTTAACCACGTCTCTAAATAAAATTCTCTGCAGTATTATTGTACTAAAAAAAAAA
page-top