Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1780
Contig Information
Length 859 bp
Tissue Shoot grown with dessication
Clones 8 Clones [Download: CSV  ,  FASTA ]
whvd14j04    rwhvd6m23    rwhvd7a19    rwhvd8e14    rwhvd14j04    rwhvd15h20    rwhvd17c11    rwhvd18f11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0848200 [Oryza sativa (japonica cultivar-group)] >gi|15408889|dbj|BAB64280.1| putative delta-1-pyrroline-5-carboxylate synthetase [Oryza sativa Japonica Group] >gi|113534333|dbj|BAF06716.1| Os01g0848200 [Oryza sativa (japonica cultivar-group)] >gi|215715215|dbj|BAG94966.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218189375|gb|EEC71802.1| hypothetical protein OsI_04432 [Oryza sativa Indica Group]
Score 855
Evalue 8.10337e-90
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1780
TGCACACCCATTGCATTCATTTCAGGTGCTCTTTGCCATAGAAAGACAACATGACAACGGATTCGAGACTTCATCAGAAACAGTACAGCTACTTCATATA
TGTAGCATAGATGTACCGATGCAATTCTACAGTTACAACAACTAGTGCCATAACTAGGACATTGTATGGATAAATCATTGTACACGAACAATCACGGAAC
TAGATAGCGACATAGTAACAACAATGCTCTCTTGTCTTTCTTCATTCCTCGCACAGAGAGAAGGGGGCTTTGAAGAGGATTATTCTACAAAAATTGCTCT
ACAGCAGGAATCCTCTACCCTCATTGCAAAGGAAGATCCTTGTGGGTGTACACAACTCCCTTGTCGCCGTTCACTACTTGTCCACTCCCTCGAAGAATGC
ACCGAGTGGTTAAAAGACCGTCGACACCAACAGGTCCACGAGCATGTATGCGCCCTGTACTTATGCCAACCTCTGCACCTAGACCGAAGCGAGTCCCATC
ACAGAACCTTGTGCTTGCATTATGGAACACAGCAGCACTGTCAACTTGTTGTAGAAAAGTATCTGCTGACTTCTTATCAGTTGTGATAATACAATCTGTG
TGTGCACTTCCATAACGATTTATATGGTCAATCGCTGACTGCACATCATCAACAAATTCGAGGGTGCATGCCATTGAGCTATACTCATGATGAAATGAAT
CCACCTTTGGTACTTTCAATGTGTCATGTGCGACAGGCCCACCATAAATAACAACTCCTTCTTTCGCAAGTTCCATCAATAAATCATCAAGACCCTCTGT
CTTGTTCAGATCTTTATGAACAAGTAGTGTTTCCATAGCCATTGCATGCTGCAGGATAA
page-top