Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1757
Contig Information
Length 1319 bp
Tissue Shoot grown with dessication
Clones 7 Clones [Download: CSV  ,  FASTA ]
whvd10a05    whvd9j22    whvd17i11    rwhvd10a05    rwhvd9j22    rwhvd17i11    rwhvd20o09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 14-3-3 protein homologue [Hordeum vulgare subsp. vulgare]
Score 1308
Evalue 4.64124e-142
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1757
TCAACTTATTGACTTAGAAGAATCCTAGAACTCAATTATTTTGAGAGGGAAGTAGACAAGAAAAACTCAGCCTGTTGCCTCATTAGAAAGGCAAGCTTTG
GGGGTGCTTGACGCCAAGTATGATCAATCATCAACAAGCCATGAAAATTGCTAATACAGCAATACTAATAATGTGCTGCAATACAGGAAATAGTTTGAAA
TCTGCTAATGAACTAAGAAGCGACGATGTCCACATGACCGTCCTCATGACTGTAGTCCACTAGGTACTTCAGCTCGACACGCTTCGCATAGCACCATCCT
ACCACATCTTATGATTCACATAGTGCAACCGACCCTAGTACATCTTATGATCCGAATGATACAGGTAGCTGCGTAAATGGACTCGGAAATAAACTTGGGC
ACGCTCGAGGGCCAGCCAATCAGTGCCCCTCTCCCTCAGGCTTTGAGGCGGCTTCCTTGATCTCATCACCACCCTCCTCTGCGTTATCGGAGGTCCAGAG
AGTCAAGTTGTCACGAAGAAGTTGCATGATCAAGGTGCTGTCCTTGTAGGATTCCTCGCCGAGGGAGTCCAGCTCAGCAATGGCTTCATCAAATGCCTGC
TTGGCAAGGTTGCAAGCACGGTCTGGAGAGTTCAGGATCTCATAGTAGAACACTGAGAAGTTGAGTGCAAGTCCAAGCCTTATCGGGTGGGTGGTAGGCA
AGTCAGCAAGCGCGATGTCCTGGGCTGACTTGTATGCTACAAGAGTGTTCTCAGCTGCTTCTTTCCTCTCAGCGCCTGCCTTGAACTCCGCAAGGTACCT
GTGGTAGTCACCCTTCATTTTCAGATAGAACACCTTGGACTCTGCTGCAGTGGCAGAGGGGACAAGGTGGGAGTCCAGAAGCTTGAGGATGCCATCACAG
ATCTTGCTGAGCTCGGTTTCAATCCTGGTACGGTACTCCTTGATTGAAGCAACATAGGCCTCGTTCCCACGGCTCTCCTCCTTCTGCTCAATGGAGGAGA
TGATCCTCCAGGAAGCCCTCCGGGCACCAATCACATTCTTGTAAGCCACAGAGAGCAGGTTGCGCTCCTCAACAGTGAGCTCACCAACATCAGCGGTCTT
TGCGACCTTCTCCATGAACTCAACCATTTCCTCGTAACGCTCAGCCTGCTCGGCGAGCTTGGCCATGTACACATTCTCCTCACGGGTTGCCTCAGCGGTA
GACATTTTCCCTCTTCTTTGTTGCAAACTAGTTCAGTGCCTTTCCTCTCGCGCTTCGCTGCTCTCACGGGCTTCGGCTGCGGATCTCGGGTGCGCGCTGT
GGGTTCGTGGGGGGAGGCT
page-top