Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1756
Contig Information
Length 1269 bp
Tissue Shoot grown with dessication
Clones 7 Clones [Download: CSV  ,  FASTA ]
whvd10d02    whvd2a19    whvd6d20    rwhvd10d02    rwhvd2a19    rwhvd6d20    rwhvd9j05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit myo-inositol-1-phosphate synthase INO1 [Xerophyta viscosa]
Score 1561
Evalue 2.01539e-171
Total Hit Count 466
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1756
TACTACTTAATTAACTTACAAAACACGAACAGAGGGAGTGGACTAACTTAGCTAACACGAACCCTCCTCCCTCCACATCATCCAACACCATGGAGCCCAT
GAGAAGCTACCAAGTCGCAGAGACCAGACAGAGAGCCGAAATAGTCTCGCAAGGACACACACACACACTACAGGGTAAACTTAAACAAGGGAAAGAATCG
CAAAGGAAACTAAAGACAAGCCGCCAAATAATTGCACAGCCGATCTCGCCTTCTTCTTCCTCCTGCCCTCCCGTCGCCCCCCGCCACTTGCTACATACGT
ACGGTCGCTCTCGGCCCTGCGAGCTTGGGCCATGCTCCTCACTTGTACTCCAGGATCATGTTGTTCTCGGGCGCCAGGCCGACGCAGGCCCTCATGATGT
TCTCCAGCATCGCCCTCTGCTTCGCCAGGGCGTTCACCACCGGTGTGCCAGGAGGAACCAGGGGTGCCTTGGTGAGGTAGCTCAGGATGGTGGCAACCGG
ATGGAAGGAGTGGAACTTGTCCTCTCCCTCGGCTTTCAGCTGAATCCTGGTGCTGAGCTCGGCCAGGAGCACCAGGTCAAGGATGATGGGTGCGGCGAGG
AGCGAGTCCTCGCAGGTGTTGTGCAGCACGATGGTGCTCTTGCCCCCCATGAAGATCTCCGAGGTGTACTCGTCCATGGCCCTCTTGCTGTCTCCAACGT
ATGGCACATACTTGATCACGACGACGTGGTCAGGATGCTCCCCGGGCTCGTAGAGGATAGCATTGCTCGAGACCATGTCATCCACCACGTTGCTCTTGGA
GATCTCCTTGGAACGGAATGTCTGCGGTGCGGATAGGTTCATCCCGTCGTTGTTCCCCAGATGGTTGTAGCTGACAATTGAGGTGGGCTTGATTCCAGCA
CCAACAAGGAAATCCACCAAGACAGATTTCATCTTAGTCTGGCCACTCTTGAAATCATCACCACCAATCAGGCAGTTGTTCTTAATGGCAAGATCGATCA
GCCCAGGCACAAAGGTGTTCTGAGGGCTCCCGTTGATGAACGGCACACCCTCCATGACGCAGGCAATGGCATACAGTGTCGATGGAGATATCTCTGCCTC
GTTCTTGTCCACAGACGCCAAGAGGTTCTCCATCGTGTCATTAAGCCCAACAGAGACGTTGCTGTACCTTTCAGTGTTTGCCGTCCAAAGCACCACTACC
TTGTCCACCTTGTTCTTCTCCTTGAACTCCCTTATGTCTTTGATAATCTGCTCCATCTGCTCTTTCTTT
page-top