Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1751
Contig Information
Length 1309 bp
Tissue Shoot grown with dessication
Clones 7 Clones [Download: CSV  ,  FASTA ]
whvd10c07    whvd5i19    rwhvd5i19    rwhvd16d02    rwhvd16d13    rwhvd16h05    rwhvd17c01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0156300 [Oryza sativa (japonica cultivar-group)] >gi|54291859|gb|AAV32227.1| putative disulfide-isomerase [Oryza sativa (japonica cultivar-group)] >gi|57863918|gb|AAS55771.2| putative disulfide-isomerase [Oryza sativa (japonica cultivar-group)] >gi|113578247|dbj|BAF16610.1| Os05g0156300 [Oryza sativa (japonica cultivar-group)] >gi|215678906|dbj|BAG96336.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692773|dbj|BAG88199.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215704383|dbj|BAG93817.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218196130|gb|EEC78557.1| hypothetical protein OsI_18529 [Oryza sativa Indica Group]
Score 1522
Evalue 7.01626e-167
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1751
AACCCTTTTACTGCTAAAGTAAATCCCTGTAACCATAAAGGCTAAACGGCAGAGAAAACAGATATCATATGTTGTTCAACATTGAACCAAAATAAGATAA
ATCTATCGCCGCTAAACTTTCACTGCCATCTCTCTGATCTCTATCTCTCTTTGTCTTTCTTCACTTCTCTCTTGTGGCAGGTGGTACTGTTGCACTACTG
ACTATGGCACGTGGGTCACCACCACTAAGAGGAGAAGGCTGAAAGAATGTTCTTCTTGATGGCGAATTCATCGGCTTTGGAAGGACTGATCGACTTCTCC
AACAAGCGATGAAGCCTCTCAGTTTCCTTCTTGGTATAGTCAGAGCCCTTCTGCAATATCTTCTTTGCAACATTCACATAGATCTTTCCGTGCTTGACAG
CAGGACCACTGAGCTTCGCAGCCTCCTCTTCAATTTTAGAGAGGATTTCCTTCCGCTTGTCATCAGCAGCACTGTGGAATTCCTTGACAAGAGCATCCAA
ACTTGCCACAAGCCCAGCCTCTGAAGTAAGCTGACCCTTCGAATCACGGCTAGTTCCACTTTTCTCATTAATGAACTTAACAAAGTCATCCAACTCCCGA
CCGCTCTCATACTCTTCACCAGCTTTGTTACCCTTCGGGAAGAACTTCAATGTGGGAAAACCAGAAACTCCATACTTCTCAGCCAAGCTTGTGTATTTGT
CAGCATCAAGATTAGCAATCACGACACCCTCATCTTGCTTGAAAACAGAGGCCACCTTCTCATATATCGGAGCAAGACTCTTGCAGTGACCACACCATGG
GGCATAGAACTCAACAAGGACATCTTTGGTTTCATCAAGGACAACTGAGTCAAAGGTTTCCTCGGTCAGAACCACAACACTTGAAGGAACTGCTGCTATC
TTCACATTGGTTGCTGCTTCAGAGTTAACATATTCTGTAAGGGCTTCAGCAGTGCGTTGACCCTCATACTTCTTGGGCTCCAAGGAACCTTTGGGAAACC
ACTGGATTGTGGGGTAGCCAGAAACTCCATACTTGCTGCACACACTCTTGTGCTCATCGCAGTCAACCTTGGCAATCAAGACTGATTTAGCCTTTTTAAA
ACTTGCAGCAAGCTTCTCATATTCTGGAGCAAGCTTCTTGCAGTGGCCACACCAGGGAGCGTAGAACTCGACGAGCGCGCCACGATCCTGGCCGACCTCC
TTCTCGAAGGTGGATCTCCGTGATGGGCGAGCACCTCGTCGCCGTCGGCGGCGGCTGGGTAGAGCGCCGCGGCGGCGAGCAGGAGGAGGACGGGGAGGAG
GGTTTTGCG
page-top