Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1657
Contig Information
Length 1269 bp
Tissue Shoot grown with dessication
Clones 6 Clones [Download: CSV  ,  FASTA ]
whvd14h06    whvd17j10    whvd18g09    rwhvd14h06    rwhvd17j10    rwhvd18g09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Glyceraldehyde-3-phosphate dehydrogenase, cytosolic >gi|18978|emb|CAA42901.1| glyceraldehyde 3-phosphate dehydrogenase [Hordeum vulgare]
Score 1644
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1657
AAAAAGAGTACTTGATTAGCAACTCCATTACAGATACTAGTTGATGCGGAAAACAGAAGGTAACTCATGTCCAACTAACATGAACCAGGCGTCGTCTGGC
GACGCCATCCACATTTATTCTTCGCATAGACAAAGCAGGGACACCTCTGACCAGGCGCCACAAAGGAAAGCAGAGCACTCTACTGAGTCTTGGCCATGTG
GCGGATCAGGTCGACAACGCGGTTGCTGTAACCCCATTCGTTGTCATACCACGAGACAAGCTTGACGAAATGGTCGTTCAGAGCAATTCCAGCCTTGGCA
TCAAAGATGCTCGACCTGCTGTCACCAACAAAGTCGGTGGAGACCAAATCCTCCTCAACGTAACCCATGATCCCCTTGAGCTTCCCCTCAGATGCAGCCT
TGATAGCCTTCTTGATGTCATCATATGATGCAGCCTTCTCGGTTCTAACAGTGAGATCAACAACTGACACATCCACAGTGGGAACCCGGAAAGACATACC
GGTAAGCTTGCCATTCAGCTCAGGAAGAACCTTACCAACAGCCTTAGCAGCACCAGTGCTGCTGGGAATGATGTTAAAGCTTGCGGCCCTGCCACCTCTC
CAGTCCTTGCTCGAGGGACCATCAACGGTCTTCTGTGTGGCAGTGATGGCATGAACAGTGGTCATCAAACCCTCAATAATACCGAAGTTGTCATTAATGA
TCTTAGCTAGGGGAGCAAGGCAGTTAGTGGTGCAGCTAGCATTTGAGACAATGTTAACGTCTGAGGTGTACTTGTCCTCGTTGACACCAACCACAAACAT
AGGGGCATCTTTGCTTGGGGCAGAGATGACCACCTTCTTGGCACCACCCTTCAAGTGAGCAGCGGCCTTGTCCTTGTCAGTGAAGACACCGGTGGACTCC
ACAACGTAATCGGCACCAGCCTCACCCCACGGGATCTCCTCAGGGTTCCTGACGCCGAAGACGGTAACTGGCTTCTCGCCAAAGAGCAGAGTCTTGTCGT
CCTTGAGCTTGATGTCACTGTGCTTCCAGTGGCCGTGAACGGTGTCGTACTTGAACATGTAGGTCATGTACTCGGTGGTGATGAAGGGGTCGTTGACGGC
GACGAGCTCGACATCGTCGCTCTGGAGAGCTACCCTGGCGACGAGCCTCCCGATCCTTCCGAAACCGTTGATTCCGATCTTAATCTTGCCCATGGCGAGG
GAGTGGAACTGCCGCCGCGACGCGAGACGGAGATGGGAGGTTGGCTGGGGACGGGACGGGACGGGAGAA
page-top