Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1537
Contig Information
Length 849 bp
Tissue Callus
Clones 4 Clones [Download: CSV  ,  FASTA ]
whcs6a16    rwhcs10f19    rwhcs3g16    rwhcs6a16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 913
Evalue 1.50463e-96
Total Hit Count 151
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1537
TCATACATTAAGAAACATTCATCCTTTTCTACCAGTGTTGCCAGAGTACATAGGTGAAAAAGATAGCTCGCGGCTTCGTAATTAGTAGCGCTCGTAAATA
ATATCAATAATAATACAATTACAACGTATAACTGTCTGATCAGACGACAAGCTAAAAACAAAACTTGCAGGGCCTAGTGGTGCTTGTTCAGATCAATTCT
TCAGTAGTTTCCTCAACACGTCTTCAGCATGACGCTCCATCTTTGGTAAAGCCCAGTCATGCTGGATGATGTCGAGGCTGTCTTTCTCTGCGCTCAAGCT
CATTGCTGGATTAAAGCCCATTCCACCACCCATCGCCATCATCTTTTGGGCATCATCAGTAGCTGCATAAACATTTTCTTCACCAAGGATGAGACTGAAA
AGACCCCTCAAGCCAAATAAATTGAGGAAGTACCATGAACGGCTGCTAACATAGCTCACATCAACAGTACTCAGGTCTATCCCATTTTGCAGCATTCCCC
TGAATCGTTGAGTCAATGGAAAGGGGATTTTGGCTGCAACAAAACCGGAAAAGAAGAAGTTCACCCATGCAAATGTAAGTGTCTGTGGAACTATCATGGA
GAGATTCTTCTTCATCATATCCATGGCCATGTTTGGGTCCGAAAACATAGCCGCCTGAGCCTTCTGGGCATCCTCTTTAGGAACATGAAGCAATCCTGCT
TCCCCGTTGGTGTAATAAAGCTTGCGAGCCTTGAAGGCCTTGGCCGGGATGAACTGCGCGCCGTTCCTCAGGTTCCTCGCCCTGATGACGACCTGCCCCT
CCTTGACGGTCTTGGGGTCGGGGGAGGGCGAGGCCGACGGCGGGGAGCG
page-top