Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1644
Contig Information
Length 1517 bp
Tissue Shoot grown with dessication
Clones 6 Clones [Download: CSV  ,  FASTA ]
whvd10f10    whvd1n01    whvd7f08    rwhvd10f10    rwhvd1n01    rwhvd7f08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0498700 [Oryza sativa (japonica cultivar-group)] >gi|48475219|gb|AAT44288.1| putative B2 protein [Oryza sativa (japonica cultivar-group)] >gi|51038049|gb|AAT93853.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579502|dbj|BAF17865.1| Os05g0498700 [Oryza sativa (japonica cultivar-group)] >gi|218197041|gb|EEC79468.1| hypothetical protein OsI_20486 [Oryza sativa Indica Group]
Score 1361
Evalue 4.01547e-148
Total Hit Count 105
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1644
CGCCTCTCTGACCGGTGGACTCCGTGTGGGCGGAGCGAAGTGGGAGCCAACGCCAAGCCAGCCGAGCGGACTCCTCTCCTCCTCGCAGCAGTTCGCGATT
CGCCCCCAAATCCAGCGCCCTCCCCGCCGGAATCCGGCGCCGAATCTTGCAGAGAGCTTGAACCGAGCTATGGACAACTTGTGGCATCTCGGAGATGAGT
TCCGTGGGCAATCAAAGGTGGTGGAGGACCGCCAATGGTCTCTCATGACATCAAAGCTGGCTGAGATCACAAAGTCAAAGGCTGAGAGGATGAATGACTT
TGAGTATGCACGGATGAACACCGTCCCTGATGTGAAGCAATGGGATAAGTTATCCTACCACCAAGAAGACAACAAGATGGACCACCTCAATCTTGGCCTC
ATGAACCTGGATCTTAAGATGAATGATCTCAAGATGAACGAGGCTGCCATGAAGTACCCTTTCCGCAACATGGCCTATAACATGAATCCGATGTACCCCA
AGGGAAACAATGGTAATGTCAATTCATTCAAGATGAATGTCGGGGTCAACAAATATCCGAATAATCAGAATGGGAAGGAAGCAAACGGCAAACACAATGG
TGGTAACAACAACAATGGAGGCAACAGCAACAACAACTCTGTTGACAAGCGCTTCAAAACATTGCCAACAAGCGAGATGCTACCGAGGAATGAAGTTCTT
GGTGGATACATCTTTGTCTGCAACAATGATACCATGCAGGAGGATCTCAAGAGACAGCTTTTTGGCTTGCCAGCAAGATATCGTGATTCAGTCCGAGCCA
TCACTCCTGGTCTACCTCTTTTCCTCTACAACTACACGACCCATCAGCTACATGGGGTGTTTGAGGCTGCTAGTTTTGGAGGATCAAACATTGATCCCAC
CGCTTGGGAAGATAAGAAGTGCAAAGGTGAATCCAGATTCCCAGCACAGGTGAGGATCCGCATTAGAAGGCTTTGCAAGGCCTTGGAAGAGGATGCTTTT
AGGCCAGTGCTGCACCACTATGATGGTCCTAAATTCCGCCTCGAGCTCTCCATAGCAGAGACACTGTCACTGCTGGACCTGTGCAAGACGGAAGACGCCT
GATCTGCTTTGGAACATGGTTGTGGTTGCTCTGTGGTTCTTTTTAGTAAATATCATCCCTGTAAGTTGTGGAAGATGTTTTCACAATGATCTGTTCCGTC
CGTCGTCTATGAAAGCGCAAGCTGTTGGTTGGTGGTGCATTTCCCCCAGAAAGGACCTGGTACTCGGAAGAAGTAGGCCTCTAAAGATGTGAGCCTGTCT
GTGTCGGTGCCGTCTGTCCGTAATCTCGGTGATGTGTATGTTCTTCTTCATATTTATGTATTTGTAGTGCAGTATGCCCGCCGCCAGCGGGGAAACCCCG
AAAGACGGGGGATACTGTTGTGATGCATCAGGAACGCCCCAAAGTGAGGGTGGTTGATGTTGGGAGTGTATCTTGTTGTCTCTGTACCTTACCTTGGTTG
GAAAGTGGAACCTGCAT
page-top