Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1600
Contig Information
Length 1516 bp
Tissue Shoot grown with dessication
Clones 5 Clones [Download: CSV  ,  FASTA ]
whvd1l02    whvd1n08    whvd8e14    whvd14c13    whvd15h20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_003971 [Oryza sativa (japonica cultivar-group)]
Score 1928
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1600
GCCACTTCCACCCACCTTGACCTCGCCTCGCCTCGCCTCGCCCACCCGTTCTTTTTTTTCCTTGCCCGTCTCGATCCGGAGCGAGCGAGCGCCCGCGGGT
CGCCACTCCCCGGCGAAGCGGAGAATGGGCAGGGGAGGCATCGGAGGCGCCGTCGCGGCGGCGGACCTCGAGAACAGCGACTCCACCCGCGGCTTCGTCA
GGGACGTCAAGCGCATCGTCGTCAAGGTCGGCACCGCTGTTGTCACCGGGCAGAATGGCCGGCTGGCCATGGGCAGGCTCGGAGCTCTCTGCGAGCAGGT
GAAGGAGCTCAATTTCCAGGGGTATGAGGTGATTCTGGTCACCTCCGGCGCCGTTGGCGTCGGGAGGCAGAGGCTCAAGTACCGAAAGCTTATCAACAGC
AGTTTCGCCGATCTGCAGAACCCACAGCTGGACCTGGATGGGAAGGCCTGCGCTGCCGTCGGCCAGAGTGGCCTAATGGCTATCTATGATACGCTGTTTA
GCCAACTTGATGTAACATCGTCTCAGCTTCTTGTTACGGATCGTGATTTCCGGGATCCAAGTTTTGGGCACCAGCTTCGTGAGACTGTTGTCTCCCTGTT
AGATCTTAAGGTGATACCGGTGTTTAACGAGAACGATGCTATCAGTACGAGGAGAGCGCCATACGAGGATTCATCCGGTATATTCTGGGATAACGACAGT
TTGGCGACGCTGTTGGCAAAAGAACTGGATGCTGATCTTCTTATCATGCTTAGTGATGTGGAGGGACTCTATAGTGGTCCACCGAGCGATCCTCAATCAA
AGATTATCCACACATACATCAATGAAAAACACGGGAAGCTAATTAATTTTGGGGAGAAGTCTCGTGTGGGAAGAGGTGGAATGCAAGCTAAAGTGGCAGC
TGCTGTTACTGCTGCATCAAAGGGCGTACCTGCTGTAATTGCAAGTGGATTTGTAACAGATAGCATTATTAAGATTATGCGAGGAGAGAAAATTGGTACA
CTTTTCCATAATGAAGCAAATGTCTGGGATTGTTCGAAGGAGGTGACAACCCGTGAGATGGCAGTTGCTGCAAAAGATTGTTCACGGCATCTCCAGAATT
TGTCATCGGAGGAGCGTAAGAAGATTTTGCTAGATATCGCCGGTGCTCTGGATGCAAATGTGGATTTAATTATATCCGAGAATGAAGCTGATCTAGCTGC
GGCACAAGATTCAGGTTACGAGAAATCCTTGGTTGCTAGGATGACCCTGAAGGCAGGAAAGATAACAAGCCTTGCTGAATCGATTCGTGCAATTGCGGAC
ATGGAGGACCCTATCTCACATACACTGAAAAAAACAGAGGTTGCTAAGGATTTAGTTTTCGAGAAGATGTACTGCCCATTAGGTGTTCTCCTAATTATTT
TTGAGTCTCGTCCTGATGCCCTGGTCCAGATTGCAGCTCTAGCAATCCGAAGTGGAAATGGCCTTCTTCTGAAAGGAGGAAAAGAAGCTATGAGATCAAA
CNCAATATTACATAAG
page-top