Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1587
Contig Information
Length 1568 bp
Tissue Shoot grown with dessication
Clones 5 Clones [Download: CSV  ,  FASTA ]
whvd10c10    whvd13k11    whvd18p21    whvd19c21    rwhvd18p21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_021523 [Oryza sativa (japonica cultivar-group)]
Score 2300
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1587
CCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCTCCACCTTGTCCTCCGTCTTCGGGGAGGCATGCAGATCTTTGTGAAGACCCTCACTGGCAAGAC
CATCACCCTTGAGGTGGAGTCCTCGGACACCATCTACAACGTCAAGGCGAAGATCCAGGACAAGGAGGGCATCCCCCCTGACCANCAGCGCCTCATCTTT
GCTGGCAAGCAGCTGGAGGATGGCCGTACCCTTGCTGATTACAACATCCANAAGGAGTCCACCCTTCACCTTGTCCTGCGTTTACGANGTGGCATGCAGA
TCTTTGTGAAGACCCTCACCGGCAAGACCATCACCCTCGAGGTTGAGAGCTCCGACACCATCGACAACGTCAAGGCCAAGATCCAGGACAAGGAGGGCAT
TCCCCCGGACCAGCAGCGCCTTATCTTTGCTGGCAAGCAGCTGGAGGATGGCCGCACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCTCCACCTT
GTCCTGCGGCTGCGTGGTGGCATGCAGATCTTCGTCAAGACCCTCACTGGCAAGACCATCACCCTTGAGGTTGAGAGCTCCGACACCATTGACAACGTCA
AGGCCAAGATCCAGGACAAGGAGGGCATTCCTCCGGACCAGCAGCGCCTCATCTTTGCTGGCAAGCAGCTGGAGGATGGTCGCACCCTCGCTGACTACAA
CATCCAGAAGGAGTCCACCCTCCACCTTGTCCTGCGTCTGCGTGGTGGCATGCAGATCTTCGTGAAGACCCTCACCGGCAAGACCGTCACACTTGAGGTG
GAGTCGTCTGACACCATTGACAATGTCAAGGCCAAGATCCAGGACAAGGAGGGCATTCCCCCGGACCAGCAGCGCCTTATCTTTGCTGGCAAGCAGCTGG
AGGATGGCCGTACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCTTCACCTTGTCCTCCGCCTTCGTGGAGGCATGCAGATCTTCGTCAAGACGTT
GACTGGCAAGACCATCACCCTTGAGGTGGAGTCGTCTGACACCATCGACAACGTCAAGGCCAAGATCCAGGACAAGGAGGGCATTCCTCCGGACCAGCAG
CGCCTCATCTTTGCCGGCAAGCAGCTGGAGGATGGCCGCACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCTGCACCTTGTCCTCCGCCTTAGGG
GAGGCATGCAGATCTTCGTCAAGACCCTCACCGGCAAGACCATCACACTTGAGGTGGAATCCTCCGACACCATTGACAACGTCAAGGCCAAGATCCAGGA
CAAGGAGGGCATTCCTCCGGACCAGCAGCGCCTCATCTTTGCCGGCAAGCAGCTGGAGGATGGCCGCACTCTTGCTGATTACAACATCCAGAAGGAGTCC
ACCCTACACCTGGTGCTCCGCCTCCGTGGTGGTCAGTAATTGCCCTGACGTTGGAACCTGCTGCTATTAGTCCTGTGTCTTGTTCGTGTTAAGTCTACTG
TATCTGGTTTGATGGACCATGAGTCCTGATGATGTGTGTTGGTTTCGGGGAAACAGTTGCTGGATGTT
page-top