Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1526
Contig Information
Length 1364 bp
Tissue Callus
Clones 4 Clones [Download: CSV  ,  FASTA ]
whcs10d19    whcs10d20    rwhcs10d19    rwhcs10d20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27440 [Oryza sativa Indica Group]
Score 982
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1526
ATCTTTCTTAAGCAGGACAACCTTATTCAAGGTCGCTTCCTCGCTGAATTAACTAAAGAAGTGTTTGCTGACCTTGAAGCAAGCAAATATCAGATGGCTG
AGTATCGAATATCTATTTATGGGAGAAAGAAAAGTGAGTGGGATCAGATGGCAAGTTGGATAGTGAATAACGAATTGTACAGCGAGAATGTTGTTTGGTT
AATCCAGATTCCTCGGATTTACAATGTATACAGGGAGATGGGCACGATTAATTCATTCCAGAACCTCCTTGACAACATTTTTCTTCCACTTTTTGAAGTA
ACTGTTGATCCTTCTTCACATCCTCAGCTGCACGTTTTCTTAGAACAGGTTGTTGGTTTAGATTTGGTGGATGATGAAAGCAAACCAGAAAGGCGCCCAA
CAAAACACATGCCGACTCCTGAGCAATGGACTAATGTTTTCAATCCAGCGTATGCATATTATGTATACTATTGCTATGCTAACCTCTACACACTGAACAA
GCTTCGTGACTCCCAAGGGCATGACAACAATCAAACTTCGTCCACACTGTGGAGAGGCTGGCGATATTGATCATCTTGCTGCAGCATTTCTCACTTCTCA
CAATATTGCTCACGGGGTGAATCTAAAGAAGTCCCCTGTCCTCCAGTACTTGTATTATCTTGCTCAGATTGGTCTTGCAATGTCTCCTTTGAGCAACAAC
TCGTTGTTTATTGACTACCACAGGAACCCGTTCCCAACATTTTTCTTAAGAGGCCTGAATGTTTCTCTCTCAACTGACGACCCTTTACAAATTCACCTAA
CAAAAGAACCTTTGGTTGAAGAATACAGTGTTGCTGCTTCGCTGTGGAAGCTTAGCTCTTGTGACTTGTGTGAAATAGCCAGGAATTCTGTGTACCAGTC
TGGTTTCTCTCATAGGCTGAAGTCACACTGGATTGGTAGAAACTACTATAAAAGAGGTCCCGACGGCAATGACATCCACCAGACAAATGTTCCTCACATT
AGGATTGAATTCCGACACAACATTTGGAAAGACGAGATGGAGCTGATACATTTTGGAAATGTTAAGCTACCAGAAGAAACTGATAGATGAAGATCTTGCG
GCAGTTTTGAAAGCCCTGCACTTCAGGCATTGCATCCGGTTTTCTGGCTTTCGGAGAAGAAGCAACCCTGTGCTGGTCTGTGAAAGAGAAGAAAAGTGCC
CAAGTACCTTTTCGATGAGTCTTTTACTCCTGTTGCTTGTATAGGCAAATATTAGCATGGAAGGATAAGGAGAAGACACTCTAGGATTTCAGTGGAATAT
ACTGCATCAGGCGTATCGTTGCTCACTCGGTACATTAGTTAGTGACCTTCCCTTGGAATAAAAT
page-top