Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1528
Contig Information
Length 795 bp
Tissue Shoot grown with dessication
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvd10f22    whvd6k09    rwhvd10f22    rwhvd6k09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit thioredoxin H-type 5 [Zea mays]
Score 638
Evalue 1.03589e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1528
TAGTCCAGCATGAACAGCTACTATTACTACTTGGAGGACTCGCGGCAGTGGTTCTGGTGGAGCGCCGGCTGGCGCAAAACTAACGATGGCAGACGTTATC
CTGCAGTTAATATAGTTATATTAACTGAGGTCTCCTTCGACTATGTGTTCGGCAGAGAACCATTAACCGAACCCCCTCAGGATAGCTCTCCCGGAACTGT
GATCTCGATCAAAGATATGGAGGAATGGCAATCGCGTTGGGACAATTCTGCTCGATACAACAAGCTGTTGGTGTATGCGTTCTACGACAAGAATTCCACA
CTGTCCAAGGCCATGGACAAGCTGTTGGAGAAACTCGCCAAGCAGTATAAAGGCAAGGCAGACTTCTGCAAGTTGGACGTCGACAACTTCGAGTTTTTGG
CGGGGCTTTGCGGAGTGGAGGGAGCGTATCCGACGTTCGTGCTATTCAAGAAGTGCAAGCAGGTGGGCAAGGTCGTCGGCCTCAAGGACGACGAACTCGA
GCGGAGCATCGAGCGAGCGCTAAACTAGTACTCAATGTTTTTCGTGTCAAGACTTATAATATGGCCTTCATATACGCATCGGGAGTGCGAGGTACATGCA
TGTGCATGCTACAGAACTACTGTATGTAGCTGGAATAAGCATGGTACGAAACTTGTCGAGAGATGTTGAGTATCAGATGTACTACTCCATGGACCTATAT
ATGCTCCTGCATGGTATATGAGCTAGAATTTTAGGAGACATAAATATTAAAAATTCATGAATAAATTTAGCATTTATAACTAATCAAAAAAAAAA
page-top