Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1426
Contig Information
Length 886 bp
Tissue Shoot grown with dessication
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvd10b04    whvd9b04    rwhvd10b04    rwhvd9b04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0127800 [Oryza sativa (japonica cultivar-group)] >gi|77548487|gb|ABA91284.1| FHA domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113644335|dbj|BAF27476.1| Os11g0127800 [Oryza sativa (japonica cultivar-group)] >gi|125576048|gb|EAZ17270.1| hypothetical protein OsJ_031479 [Oryza sativa (japonica cultivar-group)] >gi|215678943|dbj|BAG96373.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215679050|dbj|BAG96480.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737414|dbj|BAG96544.1| unnamed protein product [Oryza sativa Japonica Group]
Score 540
Evalue 2.85245e-53
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1426
CCGTCGCAATGGAGGCAGCGGCAGCAGCGGCTAGTTCCTCTGTCCTGCTGTCGTTTTCCAGCCCGAGGAGATCAACGGCGGCTACCTTCCTCCGCCTCTC
CACGGCGTCGCCTCGCATCACGTGCTCCGCCACACAGCAGCTTCCCCTCGCTGCACCATGGTTGTCAGCCGCCGAAAAGAGCAGCACTAGAAGAAGAAGC
AGCATCCTGTCGTTAAGGTGCTCCTCGGCCGCCACCGGCAGCCCGTCGGCCGTTGTCTCTTCAGAACGATGGATTCTTGAGCCCGCAGGGGACGGCGACT
GGAAACACATCGGCTACCGCGTCGCCCGCCCCGGCGCCATCGAGATCGCATCCGAAGCGATGACCGTGGGACGAGTTCCGGAGAACGCCGACGTCGTCAT
CCCCGTCGCAACAGTTTCTGGGGTGCACGCTCGGCTGGAGAAGAAGGACGGGAACCTGGTGGTCACGGACATGGACAGCACCAACGGCACCTACGTCAAC
GAGAGGAAGCTGGTACCGGGATTCCCGGTCGCCGTCCAACCCGGGAGCCTCCTCATCTTCGGTGACATCCACTTGGCAATGTTTCGGGTGAGGAAGACAA
TCGTCGATGTGGCAGCCGAGGCCACCAAAGATGACCAGCAGGAAGCTGAGACTGTGCTGGCAAGTGCAGTTCAAGAAACAAGCTAGTCTACCTTACCTTT
CAAAATAAGAGTGCAAAATAGTGCATCATGGTAATATGCAGTCCCCGTCTCAGGATCAACGAAATATGTAGCTAGGCAGAAATAGCATGTACGAGTAAAG
AGTAACTTGCAACATGTCATGCTCAAGGAACAGGTCATTCAAACAAACACACGCTAAATTTCACGCCAAAGCCTGATCTGACCCAT
page-top