Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1401
Contig Information
Length 883 bp
Tissue Shoot grown with dessication
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvd10h03    whvd13o11    rwhvd13o11    rwhvd13o23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=HMG1/2-like protein >gi|21803|emb|CAA77641.1| high mobility group protein [Triticum aestivum] >gi|114145392|dbj|BAF30985.1| high mobility globular protein [Triticum aestivum]
Score 207
Evalue 1.17159e-14
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1401
GCGCCCTCTCTCCCCCGCCCCCTCCCCCCAGGAAACCAGCCATGAAGGGGGCCAAATCCAAGGGCGCCGCCAAGGCCGACGCCAAGTTGGCGGTGAAGAG
CAAGGGGGCGGAGAAGCCGGCCGCCAAGGGGAAGAAGGGCAAGGCCGGCAAGGACCCCAACAAGCCCAAGAGGGCGCCATCCGCCTTCTTCGTCTTCATG
GGCGAGTTCCGCGAGGAGTTCAAGCAGAAGAACCCCAAGAACAAGTCCGTCGCCGCCGCTCGGCAAAGCGGCCGGTGAGAGGTGGAAGAGCTTGAGCGAA
TCGGAAAAGGCCCCCTATGTGGCCAAGGCCAACAAGCTCAAGGGCGAGTACAACAAGGCCATTGCTGCCTACAACAAGGGCGAGAGCGCTGCTGCTGCTG
CCCCAAAGAAGGCTGCGGCCAAGGAGGTAGAGGAGGAAGATGAGGAGGAATCTGACAAGTCCAAGTCGGAGATCAATGACGACGATGACGATGAGGGCAG
CGATGAGGACGAGGACGATGACGAGTGAAGAAGACGCATCTTGTCAAGGCTGCTCCGGCGGACAAGTCGGGAGCTGCTGTGCGAGAACGGACCTGAGCTG
TGTGCGGTGGTGTCATAAGGAGCCTATCCATCTCCACTAGAATTATCCCAAGTTTCACTTCACATCGTGATGTTGTTTTACCTTTTTCCTGTCATTGTCC
TGCTATAACGGATAGCGCTCCCTGTTGGCGCCGCCGCCGGCGGGGATGCCCTAGTGGTGGAGGGTGTATGTCCTCTTCCGCGGGGTGCCCCTGCTTGTAC
CTAGATGGTTACTCTTTCCGTCCATTGTCACCGGCTAACATTGTGATAATATCAGTCTGGGTAATGTTAGATTAAAAAAAAAA
page-top