Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1381
Contig Information
Length 1051 bp
Tissue Shoot grown with dessication
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvd10e01    whvd9f14    rwhvd10e01    rwhvd9f14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_00422 [Oryza sativa Indica Group]
Score 742
Evalue 1.42601e-76
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1381
CATTGCTGCTCGTCAAAGTGGTGCTGGCATTTCATGGCTCTTTCCTTTTGTGGATGGTCATCCGCCAATAGGCTGGCATGATACGATATGTTATCTTGTG
TTGCCCGTGCTACTCGTTGCTTCTCAGTTTGTCTCCATGGAGATCATGAAACCGCCCCAGAGTACTGATCCATCGCAGAAGAATACACAACTTATTTTGA
AATTTCTTCCATTTATGATTGGTTACTTCTCTTTGTCGGTGCCATCAGGATTGTCCATTTATTGGTTTACAAACAATGTCCTCAGTACAGCCCAGCAGAT
ATGGCTGCGGAAACTGGGAGGAGCAAAGCCTGCTGTGAATGAGGGAGCAAGTGGAATTATAACTGCAGGCCGAGCAAAACGTTCAGGTGCTCAATCAGGC
CAGGGTGGAGAAAGGTTTAAGCAGCTAAAAGAAGAGGAGAACAGGAGAAAAGCTGTGAAAGCACTTGGTGCAGGAGATTCAAATGGTTCAACTACATCCG
AGGATGAAGAGTCGGACGATGACACCACAGAGGAGGGAGGATCCGTAGAGGAAACATTCACTACCGGCAACGACAAGAAACTCCCTACTTACTCTGGAAA
GAAGGGCAAGAGGTCAAAGAGGAAGCGCATTGTGCAGTAACTTGACAGCCTAATTGGACTTCATTTTTGTCAACACTGGTTGATTCAATTGACCAGTGAG
CCGCCGTAGATGGTCTCGGATACAGTTTTGATGGCACAGGAGGCCAGATCTTCAGATGGGGATAGACAAAAGTTTTACTATCAGGCAGGCATTTGCTGGA
AAGCTGTAAGATGAAAATAGTTGGGTTCAGTCAGCGCAGTACGTTATGGTAGGATCGCGATGTTAATGGGTCAGGCAAGCCTGTTCCAGCCGAGAGGATA
TGTTAGAGCAGAGGTACATAAACTTTCCTGTGCTGTTCTGTATGGTGGGCTCGGAAATCGGGCAGGAATTGCATACTTTGTACACCTGTGTATTTTTTTT
CTACCCCTCCTCTTGTAATAACGCTAATAAGCATTGTTGTTCTTGGGAGTA
page-top