Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1308
Contig Information
Length 1048 bp
Tissue Shoot grown with dessication
Clones 4 Clones [Download: CSV  ,  FASTA ]
whvd2o16    whvd13l10    rwhvd2o16    rwhvd13l10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cation transport protein chaC [Zea mays] >gi|195630483|gb|ACG36635.1| cation transport protein chaC [Zea mays]
Score 945
Evalue 4.10103e-100
Total Hit Count 443
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1308
TTTTTTTTTTGCTGAAGTCGCCAAATGCATTTATTATTAGGGTATCACAAGGGAAGCAATAACACTTGAAGTCTTAGGCTTTCGCATTAGCACTCTGGAA
GCTACAGCCTTTGCCACAATAGTTGCCAAAGAAAATTAGCGCACACCCTCAATGGTGCCAGAGCTGAAGTAAACCACAGATCTTTCAATGGTAGAATGTC
AAGAGTGAGTGTGGTCAGAGGAAAATGCCATCTCTTTCGCTGATCCAGCCGTGCTGCTCTTCTTACTATGTTGAAACCGCAACGGTGCCCTCAGGAAGAG
CAGAGATGTGCACAACAGGTGTATGCGATTTTAATGGTATGTCGGAGCCGGTAACCTTCTTCTCCGTCGACCTGCTCAGCACCTTCCTCACCTCATCCGC
AAGCACAATGATCGAGTCGTCTTCATGGCTTATATTGGACAGTGCCTTCTCCATTGAGAACAGGTAGTCCCTATTATATCCATTAGGGCCACTGGCTGTA
GCAATTTGCCTTGCCATATCCTCCAAAGCAGCAGGGCCAAGATAGTATTTGTTGCCAACTGGATCAGGAGTGGATACGAAAACTAATACATCCGTCACAG
CTGGTTCCAGAGAATTTCCATCCTTGTAGAAATCCACAGAGATCTTCTGGTCATACTCGCATTCTCTTCTCTCCAAGTACTGCATTGCTTCTCGCTCTTT
TTCTAGACCACCTTTGACACAATAAGCAATTCCCCAGCATATGGCTTCATCTTCGGATTCAAGGGGTGCAGGTCCCTGGCCGGAATGCTGTGGTGTGCCT
CTATGGTCAATGCAAGCAAGATTAAACGTTCGCTTGTATCCCTTGATGAATCCCAGGATCTTCTCGTCGAAGTCGAATCCGGGGTTCCAGATCAGGGACC
CATACCCGAAGACCCACAGCACCATCCTGCTGCTGCTTTTCCCCCTGGCCGGAGGAGGGACGCCGGAGAGAATGCCGCGGGTGGGGTCGGCGGCGCGGGG
GGGGGAGCAAGATGGGGATTTGACTCTCCTCTTGCCTCGCCCGCGTCT
page-top