Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1296
Contig Information
Length 858 bp
Tissue Shoot grown with dessication
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvd16b12    whvd16d22    rwhvd1f03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal subunit 8E protein [Brachypodium sylvaticum]
Score 823
Evalue 4.16177e-86
Total Hit Count 425
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1296
GCGGCGGCGCGCAGGCGAATCAGCAGCGGAGCCAAGCAACCGACGCCACCATGGGTATCTCGCGTGACTCCATGCACAAGCGCCGGGCCACCGGTGGGAA
GCAGAAGGCTTGGAGGAAGAAGCGAAAGTATGAGCTCGGCCGCCAGCCAGCCAACACTAAGCTTTCGAGCAACAAGACAGTGAGGAGGGTCCGTGTTCGC
GGAGGTAACGTGAAGTGGAGGGCTCTCCGTCTTGACACTGGTAACTTCTCATGGGGTAGTGAGGCTGTGACCCGCAAGACCCGTCTCCTGGATGTGGTTT
ACAATTCGTCGAACAATGAGCTTGTGAGGACTCAGACCCTTGTCAAGAATGCCATTGTGCAAGTTGATGCAGCCCCTTTCAAACAGTGGTACCTGACTCA
TTATGGAGTTGAAATCGGTAGGAAGAAGAAAGCTGCTGCAGCTGCCAAGAAGGAAGCTGCTGAGGGACAAGAGGCTGAGGTTGCTGCTGCTGCCACAGAG
GAAGCAAAGAAGAGCAACAATGTCCAGAGGAAGCTTGAGAAGCGCCAGCAGGGACGTACACTGGACTCGCACATTGAGGAGCAGTTCAGTGGTGGAAGGC
TGCTGGCCTGCATTTCGTCTCGCCCTGGACAGTGTGGCAGAGCTGATGGGTACATCCTGGAGGGCAAGGAGCTGGAGTTCTACATGAGGAAGCTCCAGAA
GAAGAAGGGCAAGGGTGCCACAGCTTAGGCCGAAGAGCTGCTGCATGTTACTCGTTGGATTTTCTTAGATGTTGCGTCCATGTCATGTTTGCAGACATAC
TGAACACCATTTTCTGTAAACTGTTCGAGTCCTAGGTTGAACTGAGAATGTTTTGCCT
page-top