Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1196
Contig Information
Length 1185 bp
Tissue Shoot grown with dessication
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvd7h20    whvd19m06    rwhvd7p10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1079
Evalue 1.2369e-120
Total Hit Count 111
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1196
TCTACCGCTGAGGTCATCAGTAGAGGATAGATACATCATCTGTCCATCCATCTATCCACATGGAACTGAAGTTTAACTGAACTCAGTGCTGTCTCCACAA
GAGAAGAGAAGAGAAGAGAAGAAAAAATATATAAGACTAGTATACATACATGCATGCATGCAATCTCCAACTCCAAGGAATTTCCTTTTTGCTAGTAGAA
AAGGTAGGAGAAGGAAGGGGGGATTGTGAGGCGGGTCAAGCAAGGAATCCGAGCTTCTCTCCGTTCTTCTTGGCGAGGCGGATCAAGCCCTGCCTCTGCT
TGGGGTCAGCGCCGATGGTCTTACNGAACTCGGTGATCACCTGGGAGTGCCTTTCTCCTTCTGTCCCGCAAACCCCCGAGAGATCACACCATGTTCGGCT
TCGGTCACCACGGCCACCATGGCCAGAACCCCCCGGCCCACGCTCCGGCCGCCGCCGGCGGCAACCAGCCCACCTTCAAGATCTTCTGCAAGGCTGACGA
GGGCTACTGCCTCTCCGTCCGCGACGGCAACGTCGTCCTCGCCCCCTCCAACCCCCGCGACGAGCACCAGCACTGGTTCAAGGACATGCGCTTCAGCAGC
CAGATCAAGGACGAGGAGGGCAACCCCGCCTTTGCCATCGTCAACAAGGCCACTGGCCTCGCCGTCAAGCACTCGCTCGGCCAGTCCCACCCGGTGAAGC
TCGTGCCATTCAACCCGGAGTACCTCGACGAGTCCGTGATGTGGACGGAGAGCAGCGACGTCGGCAAGGGCTTCCGCTGCATTCGCATGGTGAACAACAT
CCGCCTCAACTTCGACGCCCTCAACGGCGACAAGGACCACGGCGGCGTGCACGACGGCACCACCGTCGTCCTCTGGGAGTGGGCCAAGGGCGACAACCAG
AGCTGGAAGATCCTCCCCTGGGGCGAAGAGGCCTACGCCGGAGGCAGCGCCAACGCCCCCCGCGGCGGCTCCTCAGAGCCCACCGTGCGCATCTTCTGCA
AGGCAGACGACGGCTTCAGCGCCACCGTCCGCAACGGCGCTGTGGTCCTCGCGCCCACCAACCCCCGCGACGAGTACCAGCACTGGTTCAAGGACATGAG
GCACAGCAACCGCATCAAGGACGAGGGAAGGCTACCCGGCCTTCGCCCTCNTCAACAAGGTGACAGGCGAGGCCATCAAGCACTC
page-top