Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1193
Contig Information
Length 1263 bp
Tissue Shoot grown with dessication
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvd10e02    whvd2g06    whvd3g06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Medicago truncatula]
Score 256
Evalue 7.37496e-44
Total Hit Count 113
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1193
GACGAGGAAGGGCGTAGCAAGCGACGAAATGCTTCGGGGAGTTGAAAATAAGCATAGATCCGGAGATTCCCAAATAGGTCAACCTTTTAAACTGCCTGCT
GAATCCATGAGCAGGCAAGAGACAACCTGGCGAACTGAAACATCTTAGTAGCCAGAGGAAAAGAAAGCAAAAGCGATTCCCGTAGTAGCGGCGAGCGAAA
TGGGAGCAGCCTAAACCGTGAAAACGGGGTTGTGGGAGAGCAATACAAGCGTTGTGCTGCTAGGCGAAGCGGTTGAGTGCCGCACCCTAGATGGCTAAAG
TCCAGTAGCCGAAAGCATCACTAGCTTACGCTCTGACCCGAGTAGCATGGGGCACGTGGAATCCCGTGTGAATCAGCAAGGACCACCTTGCAAGGCTAAA
TACTCCTGGGTGACCGATAGCGAAGTAGTACCGTGAGGGAAAGGTGAAAAGAACCCCCAGTGGGTAGTGAAATAGAACGTGAAACCGTGCTGAGCTCCCA
AGCAGTGGGAGGGGAAAGTGATCTCTGACCGCGTGCCTGTTGAAGAATGAGCCGGCGACTCATAGGCAGTGGCTTGGTTAAGGGAACGGAACCCACCGGA
GCCGTAGCGAAAGCGAGTCTTAATAGGGCGATTGTCACTGCTTATGGACCCGAACCTGGGTGATCTATCCATGACCAGGATGAAGCTTGGATGAAACTAA
GCAGAGGTCCGAACCGACTGATGTTGAAGAATCAGCGGATGAGTTGTGGTTAGGGGTGAAATGCCACTCGAACCCAGAGCTAGCTGGTTCTCCCCGAAAT
GCGTTGAGGCGCAGCAGTTGACTGGACATCTAGGGGTAAAGCACTGTTTCGGTGCGGGCTGCGCGAGCGGTACCAAATCGAGGCAAACTCTGAATACTAG
ATATGACCCAAAAATAACAGGGGTCAAGGTCGGCCAGTGAGACGATGGGGGATAAGCTTCATCGTCGAGAGGGAAACAGCCCGGATCACCAGCTAAGGCC
CCTAAATGACCGCTCAGTGATAAAGGAGGTGGGGGTGCAAAGACAGCCAGGAGGTTTGCCTAGAAGCAGCCACCCTTTAAAGAGTGCGTAATAGCTCACT
GATCGAGCGCCCTTGCGCTGAAGATGAACGGGGCTAAGCGATCTGCCGAAGCTGTGGGATGTCAAAATGCATCGGTAGGGGAGCGTTCCGCCTTAGAGGG
AAGCAACCGCGAAAGCGGGGGTCGACGAAGCNGAAGCGAGAATGTCGGCTTGANTNAACGAAA
page-top