Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1489
Contig Information
Length 622 bp
Tissue Callus
Clones 4 Clones [Download: CSV  ,  FASTA ]
whcs10f15    whcs2m05    rwhcs10f15    rwhcs2m05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100193910 [Zea mays] >gi|194694430|gb|ACF81299.1| unknown [Zea mays] >gi|195605368|gb|ACG24514.1| 60S ribosomal protein L34 [Zea mays] >gi|195605588|gb|ACG24624.1| 60S ribosomal protein L34 [Zea mays] >gi|195611046|gb|ACG27353.1| 60S ribosomal protein L34 [Zea mays]
Score 489
Evalue 1.16732e-47
Total Hit Count 307
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1489
GCCCCCTACTGCCGGCGGCGGAGACGACGGAAACATGGTGCAGCGTCTGACCTACCGGAAGAGGCACAGCTATGCCACCAAGTCCAACCAGACGCGGGTC
GTCAAGACCCCAGGTGGTAAGCTCGTGTACCAGTACACCAAGAAGAGGGCGAGCGGCCCCAAGTGCCCTGTGACCGGGAAGAAGATCCAGGGGATTCCCC
ACCTCAGGCCTACTGAATACAAAAGATCAAGGTTGTCTAGGAACCGCAGGACTGTGAACCGTCCCTATGGTGGAGTGCTCTCTGGAACTGCGGTGAGGGA
AAGGATCATCCGCGCTTTCTTGGTTGAGGAGCAGAAGATCGTGAAGAAGGTGTTGAAAATACAGAAGACCAAGGACAAGACGACCTCAAAGTAATCTGTT
TGAAACGGAAGTGCGAAGTGAGATGGTGTTCTGTAAACAAGGAAAATATTTTTGTTGGTGGTTATGATCAATGGTTTAGTCCCTTCTAGCTAAATGTTTT
AGAGTACTTGAAATCCTTCTGCCGCCGTGACATCAGAGATTGTGAAACATTTGATACCCATTTGCAGTTTCATTTCTGAATGCATGTTGAATCTACTTAT
GTTAATTTGGTCAAAAAAAAAA
page-top