Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1101
Contig Information
Length 758 bp
Tissue Shoot grown with dessication
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvd10d09    whvd3d06    rwhvd10d09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit vacuolar ATPase subunit G [Triticum aestivum]
Score 363
Evalue 7.22295e-33
Total Hit Count 43
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1101
TTTTTTTTTTGGTCGGAAATCGACAAAATTTACGAACTAATCACCAAAGGTTTAGCAAGTAGTATCAGACATGGCTGCTGCTGAACTGTAGCAGCTTATT
TCCAAGACAACAAGGAATTACAGCTGGAAGTGGCAAAAGCCATTTCTTATAATACCACCCAAAGAAATGAACAGATAGTACAAAGTTGCCATCATATGCA
GGGCTGACTCATCAACCTTTAGTTCTTCACAGTGGTGACGTGCCTCAGAAGCATCTGAATCACCTCTGGAGAGATGTTTGCTGCCTGCTGCTTGAGCTGC
TCAATCTTTACGGTTGTCTCTTGCTCAAGGCGTTTGACGTTTGCGCCAGAGTCACCGCTGGTCTCAGTGAGCTTCCTCTGGAAATCAGCCTCCATTTGTG
CACGGTACTCAGCTATTTCTCTCTCAGCCTCTTCTTTGGCTTGCCTAAGCCTCGCCGTTTTAGCAGCCCTAGCAGCATTTACAATTTGCTGAGCTTCTTG
CTCTGCAGCAAGCAATTGCTGGATTCCACTTGGGCGCCTGCTTGAGTCCATGTTTGTGCTGACGGGGAGAGGCGACTCGAATCAAGAGGAAGACGAGAAG
GATCCGTGGGGAAAAGCTATCCTCTGCTGCTCCTAGAAGATAATAGGCGCGAGTTTTTCCATGTTGCTCCGCCTGAAGATTACCACCGTCCAGCCTGTGG
CGCTGCTTCTTGGGCATGACCATGGCGCGACAGCATCCCCGCGGCGGCTCGCCGGAGC
page-top