Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1096
Contig Information
Length 1102 bp
Tissue Shoot grown with dessication
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvd10b05    rwhvd10b05    rwhvd16f20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_10505 [Oryza sativa Indica Group]
Score 1232
Evalue 2.32643e-133
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1096
CCGAAGACACAATATCCGAACACAAGATGGAAAAGTATCATGACGATTCATCATCATCGTAAAACAACGGACGGCCACCCAAGTAAGCCACGTCAGTCAA
ATTTGCCTACCATTATTGACAGCTTTGTGGGTTTGCAAAAGGAAGAGAAGGGCAAGGAAAACGAAGACTCAAAAAATTCCTCCACTTCGGCACATAATAT
GTGCGTGGATGTGGCCTTAATATACTGATGCCAAAACAAGCAATCATCTTGCCTTTGCAGACTGTAAACATGGTACACCGCTGGTCGAATCATCTAGTAA
CGGAGCATGTAGGTCCTGCGTCTGAACCAGTTGTAGTCTGGAAGAGACTTAATTGGTCCCATGGCAGCGATGGCAATATCCTGGTCAAAGATGAAGCGGT
TTGCAACACGCCTGATAGTGCTCGGATCAACTGCATCTATTCTCGCAAAAAGCTCAGGAATAGGAATTCTACGGCCATAGATGAGTTGCTGGCGTCCAAT
ATCCTCAACAACAGCAGTGGAGCCATCAAGGTGGAGTTGGATGGAGGATTTCAGCTGATTGCGTGCACGAATAACATCCTCTTCGGTAACCCTGTATGAT
AATTTGCTCATCTCTTGCATAATTGCAAAAGCCAAATCATCCAAGCAATCAGCCTTAGCGACAGCATAGACACCAAACAGGCCAGTGTCCTTGTAGTTTG
TATTGAATGCCATTATACTCTCAGCTATTTCATTGATTGCTACTCTCTGTACAAGCTCCGAACCCATGTGCTTCCCTCCTCCAGCACTCTTGTTCCACGA
ACCAAGCATAGTTTGCATAACCATTAATGCAATAGAATCAGGATCTGTCCAGGATGCTCCATTGAAGGCAACAGCAAATTGGGCCAGGGGCATGTCATCA
TCAATGATTCGTACCTCAGAACCAGTAAAAATGGCTGGCTGTTCAGCAACCAACATGTTAGTTGTTGTAGGGTCAGTTGGCAGCGATTTGAACAGCTCTT
TTGCCTGCTGTACAATATCATCATGCTTAACAGCACCAGCAGCAGTAATGACCATTCTAGAAGCCGTGTAATGCTTTTGAATGTAGTCTATGAGATTCTT
TT
page-top