Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1089
Contig Information
Length 503 bp
Tissue Shoot grown with dessication
Clones 3 Clones [Download: CSV  ,  FASTA ]
whvd10d21    rwhvd10d21    rwhvd6o23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_023670 [Oryza sativa (japonica cultivar-group)]
Score 378
Evalue 4.75911e-35
Total Hit Count 96
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1089
TTTTTTTTTTGGAATCATACTTAGTGCTTGTTGACATATTATCAACAGGGAAGTTACATTGCCGGCTTCCAAATATGAACAAACATAAAAGGCCTGAAAG
CAACACGGCCATTATGCGGATCCATCTAGCCTAGCTTGGCGAGGACATCGCCAAGAACGGTCTTGGTCTCTCCGTAGTACTTCTCGGCCTCGGTGGGGCT
CTTGATCTTGGCTGCATGGTCAAGCCCGTCGAGGGTGGCGAAGAGCTTGCCGGTGAGGTCCTTGAGGTCCTTCTTTTCCTCCTTGGTGGTCTTGGAGGAG
ATGACGGTCTTGAGGTCGTAGCGCAGGTAGGAGGCCCTCAGGCGGAGGTCGTTCATGACGTACGGCCATTGCTTCTTGTCNATGANCGGCTTGAGGTTGA
GGATGTCCTGGGCCNACTCCTTGGCCCGGACCGCCNCCTCCGCCGGTGNCANCGGCTGCAGGNANAACCGGTTCTTCAGGGGCANGNCNAANTCCCTTGC
CTC
page-top