Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1033
Contig Information
Length 884 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd10a16    rwhvd10a16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chlorophyll a/b-binding protein WCAB precursor [Triticum aestivum]
Score 1344
Evalue 1.68303e-146
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1033
CAGAACCTAGTCAATCAGAATGGCCGCAACCACCATGTCACTCTCTTCCCCAGCCTTCGCCGGCAAGGCAGTGAAGAACTTGCCATCATCATCTCTTTTT
GGGGAGGCTCGCGTCACCATGCGCAAGACGGCGGCAAAGGCCAAGCAGGTTACCTCTAGTAGCCCGTGGTACGGCTCTGACCGCGTGCTCTACCTGGGCC
CGCTTTCTGGTGAGCCCCCGAGCTACCTGACCGGTGAGTTCCCCGGCGACTACGGGTGGGACACCGCTGGTCTGTCGGCTGACCCCGAGACCTTCGCCAA
GAACCGGGAACTCGAGGTGATCCACTGCCGTTGGGCCATGCTTGGCGCGCTCGGTTGCATCTTCCCCGAGCTACTCGCCCGCAACGGCGTTAAGTTTGGT
GAGGCTGTTTGGTTCAAGGCCGGATCCCAGATCTTCAGCGAGGGCGGCCTTGACTACCTCGGCAACCCAAGCCTTGTGCACGCGCAAAGTATCCTTGCCA
TTTGGGCTTGCCAGGTCGTGCTCATGGGCGCCGTCGAGGGCTACCGCGTTGCCGGTGGACCACTCGGTGAGATCGTCGACCCACTCTACCCGGGCGGCAG
TTTTGATCCGCTTGGCCTTGCCGACGACCCTGAGGCATTCGCCGAGCTTAAGGTTAAGGAGATCAAGAACGGTCGCCTCGCCATGTTCTCCATGTTCGGC
TTCTTCGTGCAAGCCATCGTCACCGGCAAGGGTCCACTCGAGAACCTCGCTGACCACCTTGCCGACCCCGTCAACAACAATGCCTGGGCATTTGCCACCA
ACTTCGTTCCTGGCAAGTAAGGTGTGTGTGCTCCCGGTGAAGCATGCTGTTGTGTGGTCTGAGTTGTACTACCCATGATGTAAA
page-top