Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1020
Contig Information
Length 394 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd10a10    rwhvd10a10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSIGBa0157K09-H0214G12.11 [Oryza sativa (indica cultivar-group)] >gi|218195195|gb|EEC77622.1| hypothetical protein OsI_16606 [Oryza sativa Indica Group]
Score 131
Evalue 8.87082e-09
Total Hit Count 52
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1020
TCGCAGTACGCCAAGCTGGTGTGGGCGGTGCACCGCCGACCACGAGAGGTCCCTCACCTACTTCCAGAAGTCGGTGCAGGCGGCCCCGCGGGACAGCCAC
GTCCTCGCGGCGTACGCCAGCTTCCTGTGGGAGCAGGACGAGGATGAGGACGACAATGACGACGGCGGTGTTGGGGGAGGCGAGCAGGGATCACCCGGGC
GTGCTGCGCAGCCGAGGCAGCTGGCTTCCACGGCCGTTTGACTACCAGGGGTGGCCAAGATGGGCTTAACGATGTGCGTGCTGATGAGTGATGACCATGC
TTGTATGATGTTTCTGTATAATCTGCAAAATGTTTGGACCGATCGAGGTGCTGCTACGGAATAAAGAACGTAACTGTTGAGGCGAAAAAAAAAA
page-top