Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig1006
Contig Information
Length 382 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd10g02    rwhvd10g02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_004747 [Oryza sativa (japonica cultivar-group)]
Score 127
Evalue 5.62389e-06
Total Hit Count 70
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig1006
GCAAAGTGCAGGCAACGTGTTCTTGAAGCATGGCTCTGAGCTGCGCCTCATCCCCCGCGACAGAGTTGGAGCGCCGGTGGCGTCTTTCTAGTCATTGTTA
GAGTCAACAATGAAGAATCCTATATAACAGGAATAAAAGCATGTCCATGCTTGGTTGTATAATGGATGTAACATGGTTGAGTATAATCCTATGATTGACA
GGATGAATATATAGCTTGCCAGACAAAAATGTATGTCGAGCCAGTTCTGCATGGCCGGTCACACTATTGTATCGATGTTTGGTTGTTACTTCTCTCCCGT
TGAGGAGATACATGAGGTTGTTGTACTTTGTACCATGTGCACTTCTGATTTATGGATCGTATATTCAGCAGTAAAAAAAAAA
page-top