Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig995
Contig Information
Length 827 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd10b21    rwhvd10b21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12360 [Oryza sativa Indica Group]
Score 675
Evalue 5.64031e-69
Total Hit Count 399
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig995
GAGAGCGGCGGCGAAGATGGTGTCGCTGAAGCTGCAGAAGCGCCTGGCCTCGAGCGTCCTCAAGTGCGGCAAGGGCAAGGTCTGGCTCGACCCCAATGAG
GTCAACGAGATCTCCATGGCCAACTCCCGGCAGAACATCCGGAAGCTGGTGAAGGATGGTTTCATCATCAGGAAGCCTCAGAAGATCCACTCCAGGTCTC
GTGCAAGGAGGGCACATGAGGCCAAGCAGAAGGGCCGTCACTCTGGATATGGTAAGCGTAGGGGTACCAGGGAGGCTAGGCTCCCCACCAAGATCCTGTG
GATGCGGAGGATGCGTGTCCTGAGGCGCCTTCTGCGCAAGTACCGTGAGGCCAAGAAGATCGACAAGCACATGTACCATGACATGTACCTGAAGGTCAAG
GGTAACATGTTCAAGAACAAGAGGGTCCTCATGGAGAGTATCCACAAGTCCAAGGCTGAGAAGGCAAGAGAGAAGACCCTCTCTGACCAGTTTGAGGCCA
AGCGCGCCAAGAGCAAGGCAAGCAGGGAGAGGAAGATTGCCAGGAGGGAGGAGAGATTGGCTCAGGGCCCGAGAGATCATGCACCAGCACCAGCGGCTGC
AGCTCCCGCTCAGGCAGCAGCTGCACCTAAGAAGGCCAAGAAGTGAAGGTCTGATAAGAAGCTTTATCTTTCTGGTAATATCAAGGGTTAGCCTAATTTT
GGAACATCAGAAGTTCAGAACTGTTTTCTGTGCAATATCTTGTTTGTGTCAGCGTGTCGGATACCTTAAATATCATATCGTGTTTGTTCTGTTGGATGTT
TCAATCAGAGATGCTTATGCAGAGTTG
page-top