Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig1464
Contig Information
Length 841 bp
Tissue Callus
Clones 3 Clones [Download: CSV  ,  FASTA ]
rwhcs7f04    rwhcs14m20    rwhcs1l23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative cellulose synthase catalytic subunit [Hordeum vulgare]
Score 944
Evalue 3.74973e-100
Total Hit Count 478
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig1464
GTGTGTATAAATACAATTCTGACATAATATACTCTAAGCAACAAAGAACAAGTATCACAAATGGGGAAAAAAAGGAGAAAAAATCACAATGTACGCTGCA
GGTTTCGTAGGCAGTGGAGGCTTGACTGTTTGTGGTTCCCAGCAGCATGGGCGACAAGGGTACTAACAAAGGGACAATAATTTAGATAAACTCCTTCCGT
CTTCATCTACAACCAAAAAATCCCATCTAACCCCCTCCGGTATTTACACGAGGGGGGCAGATACTCACTCTTGAGCGCCGGCGATCCGATCAGCAGTTGA
CGCCGCACTGCCCCATGGCGACGGCCTTCTGGGTGTCGGAAATGAACGGGTCGATCTTCACCCACAGGAGGGAGAAGATGGAGGCGAGGAGGATGGACCA
GACGATGACGATCGTCGGCGTGCGGTTCTGCTTCCCCATGAGACCCTTGAGGAAGGGGTAGAGATGGAGGATCACCCAGATCGAGAAGAAGAGCTTTCCG
AAGAGCGGGCCCCAGGACTGGTAGCCGCTGTTGATGGCGTACGATATGCCGGCCACCATGCCCACCAGGTTGATCACGAGGACGGTGGTCGGAGGGATCA
GGAGACTGGTCCACTTGAACACGTATAGCTCGGCGAAGTCGCCGTCCTCGTCGTTCGCCTTGGATGTGACGGTGAAGTTGGTGTCGATCCCGGCCAGCAC
CTTGAGCAGACCCTGGAACACCGCGAAAAGATGGGCAGATGTGCCACCGATAACCCANAACTGCTCGTTTCTCCACCAGTCCTCGATGCCGACACCACTC
CATCGGAGCTCCAATATACCAGTGGCAAAAGATGGAGGCAA
page-top