Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VWD_all.Contig889
Contig Information
Length 838 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whvd10f18    rwhvd10f18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_027849 [Oryza sativa (japonica cultivar-group)]
Score 373
Evalue 6.01567e-34
Total Hit Count 80
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VWD_all.Contig889
GCAGGGTAATTATGGTGTTTGTGATTCCGAGGGCTCCGTTGGAGGATCAGCTTTGGTTCAGACTTCAGAGGCAGGTTTTGGGCATACCGCAGCACAAGCA
GAGGCAGATCTCAGTCAATGCTACTGCAGTTGATGATGCCCTGAAGCTTTCTTCAGTAACTGACTCAGCGTGCTGCTGTTCTCTAAGGTCGTTGAGTGCT
GAGAACAGGCAATATAATTAGGATTTTAACGAGAAGTTGGAGGAGATAAAAACTTTCAGGAAGTGTTTAGGCGAGTTCCATGCCGAAAATAATGTTATGT
GAGCAGAGAGTGCAGGCTTGTGCTCTTCTGTTGAAGAGCTTGAGCATGAGAGATTGAATCAACACATAAGTCATGAGAGCATATCTTTAGACGAGGAGAG
GCGACTGGTCAAAGAAATTAAGACCCTTGAAAAAACCAGACCGAGGGTCAGTTCCAAGGCTGCTAAGCAAGCTAAAATGCAAGATATAGTGGTTGAGAGA
GATGCCATACAGGATCAGGTGAAAATCATCATACATGGACTAAAGGAGGGAAAAGCAGCCAGGTCTAAGATTAAGGTCCTGGGCGATAAGGCGATGGGCG
TGGAGAGCTGCTACGAGCTTGCGCAGGCGGCGTACTCAACCTCGTGCTGCACACGCTCAAGCACCTGGCGGCCGTCGTCAATGGGCTCCTCGTCCATGAT
TACCTGGACAACATGAACCTCGAGGAGGTTGTGAAGGGGAACATCTGTGACGCCGTTCTTTAGGTGCTCGCCCATGTCTATGTAATTATCTCTTTATTGC
TTCTAAATTAATGCCCAACAGATTAGCGTGCTTCTGAG
page-top