Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig50
Contig Information
Length 476 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl51o04    whfl54c01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_027007 [Oryza sativa (japonica cultivar-group)]
Score 253
Evalue 1.37541e-20
Total Hit Count 412
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig50
gtACCTGAAGCGGAGGCAAATTGAGGCGAGACGAAACCCTCCTCCCTCCCCTCCCCACTCCAATCTCCATGGCTCAAGACGAGGTCCCGGAGTCCTCTTC
CCCCTCTTCGGCGGcggctgGTCGCCTGAACGCCGCCGCGCCGGAGTTCACCCCCCGATCCGCCGCCCCGCACCAagcccatccccatcgccgcgggccc
caccatcaccaccaccaccaccaccagccgcatcaccagcaccagcaccagtaccgccaccagcaccaccaccagggagaggatgagggggatgccgcgg
cggtggtggataacgctcagctcgtcctgcccgaggagctcgctcgccgggtcgtcaagcaggtggaattttacttcagtgatgtcaatctagccacaac
tgaccatctgatgaagtatattactaaagatccagatggatttgtgccgatgacagtggttgcatccttcaggaag
page-top